G135980



Basic Information


Item Value
gene id G135980
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 34951846 ~ 34952080 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU156564
AACATTTACAGAGCATTATGAAGTGGATATGGGGAAATGATATTTTTCCTTTCTTGGCTATTCTGACATGATATGCCGAGTGTTTGAGTGTCACACATTCCCACATTTTAATATAACTGTATTACAGTATCATTATCTGTTTGTGATGTTGGCTACAGTATCTTGTTGTTATTCAGCCATAAGTATCTCAGCATGGAGAACCTTGACAAGCCTGGAATATTGACAAGTATAATAT

Function


NR:

description
PREDICTED: leucine-rich repeat-containing protein 72

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU156564 True 235 lncRNA 0.35 1 34951846 34952080
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110488240 LOC106582291 coding downstream 2335 34946899 ~ 34949511 (-)
crppa ispd coding downstream 5632 34913696 ~ 34946214 (-)
meox2a meox2 coding downstream 56734 34881733 ~ 34895112 (-)
LOC110488219 agmo coding downstream 102632 34824933 ~ 34849214 (-)
dgkb dgkb coding downstream 136672 34762165 ~ 34815174 (-)
ankmy2a ankmy2 coding upstream 981 34953061 ~ 34960249 (-)
LOC110488264 LOC106605214 coding upstream 14827 34966907 ~ 34982793 (-)
LOC110488299 LOC106582320 coding upstream 84391 35036471 ~ 35086561 (-)
LOC110488304 LOC106605219 coding upstream 135096 35087176 ~ 35095775 (-)
LOC110488311 mgat1 coding upstream 144434 35096514 ~ 35099521 (-)
G135950 NA non-coding downstream 46762 34904844 ~ 34905084 (-)
G135850 NA non-coding downstream 73631 34877738 ~ 34878215 (-)
G135668 NA non-coding downstream 215812 34735621 ~ 34736034 (-)
G135522 NA non-coding downstream 350395 34600883 ~ 34601451 (-)
G135406 NA non-coding downstream 487258 34464322 ~ 34464588 (-)
G135982 NA non-coding upstream 22285 34974365 ~ 34974590 (-)
G135983 NA non-coding upstream 31444 34983524 ~ 34984165 (-)
G136002 NA non-coding upstream 64634 35016714 ~ 35017195 (-)
G136280 NA non-coding upstream 148085 35100165 ~ 35100983 (-)
G135575 NA other downstream 347368 34604215 ~ 34604478 (-)
G134668 NA other downstream 1085909 33865488 ~ 33865937 (-)
LOC110487618 LOC100380645 other downstream 1726744 33208500 ~ 33225125 (-)
G134102 NA other downstream 2163725 32748208 ~ 32788121 (-)
LOC110514821 NA other downstream 2200268 32738829 ~ 32756992 (-)
G136399 psmc4 other upstream 354287 35306367 ~ 35307729 (-)
drd2l LOC106582624 other upstream 722218 35674291 ~ 35700846 (-)
G137479 NA other upstream 1417924 36370004 ~ 36370328 (-)
G137839 LOC106605146 other upstream 1682113 36634193 ~ 36639005 (-)
G138080 NA other upstream 1873786 36825792 ~ 36828397 (-)

Expression


G135980 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G135980 Expression in each Bioproject

Bar chart with 10 bars.
G135980 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network