G147091



Basic Information


Item Value
gene id G147091
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 44215687 ~ 44216484 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU168735
ggtgtgttcagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatatgactgattgttgtcctatggacagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttaggaaatatttttgtatccaaatccggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaacggacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcgttagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcacgcccaattattcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgat

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU168735 True 798 lncRNA 0.41 1 44215687 44216484
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118940359 NA coding downstream 287406 43924190 ~ 43928281 (-)
LOC118940358 LOC106584332 coding downstream 291950 43922960 ~ 43923737 (-)
LOC110490306 LOC106584341 coding downstream 337885 43809668 ~ 43877802 (-)
LOC110490298 LOC106605170 coding downstream 431803 43776063 ~ 43783884 (-)
LOC110490292 LOC106605010 coding downstream 455337 43698959 ~ 43760350 (-)
LOC110490352 NA coding upstream 219440 44434790 ~ 44464449 (-)
LOC110490449 scmh1 coding upstream 356958 44571948 ~ 44606865 (-)
LOC118940389 NA coding upstream 513608 44730092 ~ 44737978 (-)
LOC110501618 LOC106573044 coding upstream 540914 44757398 ~ 45073140 (-)
LOC110501628 LOC106588271 coding upstream 907229 45123713 ~ 45124844 (-)
G147080 NA non-coding downstream 12185 44198593 ~ 44203502 (-)
G147081 NA non-coding downstream 13987 44198895 ~ 44201700 (-)
G146959 NA non-coding downstream 78407 44043733 ~ 44137280 (-)
G146534 NA non-coding downstream 205880 44009601 ~ 44009807 (-)
G146528 NA non-coding downstream 211966 44003308 ~ 44003721 (-)
G147224 LOC106604983 non-coding upstream 249751 44466235 ~ 44467438 (-)
G147266 NA non-coding upstream 264113 44480597 ~ 44480954 (-)
G147267 NA non-coding upstream 265974 44482458 ~ 44482711 (-)
G147291 NA non-coding upstream 301478 44517962 ~ 44518789 (-)
LOC110490183 LOC106605015 other downstream 823558 43372725 ~ 43392160 (-)
G145767 NA other downstream 943171 43270717 ~ 43272516 (-)
G145010 NA other downstream 1508408 42706818 ~ 42707279 (-)
LOC110489860 LOC106605053 other downstream 2485265 41714269 ~ 41730507 (-)
G147800 NA other upstream 646601 44863085 ~ 44863559 (-)
LOC110490531 LOC106560723 other upstream 918084 45134476 ~ 45168260 (-)
tmem86a tmem86a other upstream 2627696 46844180 ~ 46921608 (-)

Expression


G147091 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G147091 Expression in each Bioproject

Bar chart with 19 bars.
G147091 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network