G147266



Basic Information


Item Value
gene id G147266
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 44480597 ~ 44480954 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU168914
cagaccactgactcaaagaggtctcatgagctcctcctttatagtagaatccgcaaaccagtttctaaaaacggttgaaatctagtggaagccgtaggaagtgcaactttatccatatctcaatgtgtattcggtaggccaagctttgaaaaactacaaacctcagatgtcccacttcctggttggatttttctcaggtttttgcctgccatatgagttatactcacagacatcattcaaacagttttagaaacgtcagagtgttttctatccaatactaataataatatgcatatattagcatctgggacagagtacgaggcagttcactctgggcacgctattcatccaaaagtga

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU168914 True 358 lncRNA 0.42 1 44480597 44480954
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490352 NA coding downstream 16148 44434790 ~ 44464449 (-)
LOC110490335 ptpru coding downstream 57712 44084560 ~ 44422885 (-)
LOC118940359 NA coding downstream 552316 43924190 ~ 43928281 (-)
LOC118940358 LOC106584332 coding downstream 556860 43922960 ~ 43923737 (-)
LOC110490306 LOC106584341 coding downstream 602795 43809668 ~ 43877802 (-)
LOC110490449 scmh1 coding upstream 92488 44571948 ~ 44606865 (-)
LOC118940389 NA coding upstream 249138 44730092 ~ 44737978 (-)
LOC110501618 LOC106573044 coding upstream 276444 44757398 ~ 45073140 (-)
LOC110501628 LOC106588271 coding upstream 642759 45123713 ~ 45124844 (-)
LOC110490531 LOC106560723 coding upstream 653522 45134476 ~ 45168260 (-)
G147224 LOC106604983 non-coding downstream 13159 44466235 ~ 44467438 (-)
G147091 NA non-coding downstream 264113 44215687 ~ 44216484 (-)
G147080 NA non-coding downstream 277095 44198593 ~ 44203502 (-)
G147081 NA non-coding downstream 278897 44198895 ~ 44201700 (-)
G146959 NA non-coding downstream 343317 44043733 ~ 44137280 (-)
G147267 NA non-coding upstream 1504 44482458 ~ 44482711 (-)
G147291 NA non-coding upstream 37008 44517962 ~ 44518789 (-)
G147352 NA non-coding upstream 128619 44609573 ~ 44623234 (-)
G147354 NA non-coding upstream 158006 44638960 ~ 44639277 (-)
LOC110490298 LOC106605170 other downstream 696878 43776063 ~ 43783884 (-)
LOC110490183 LOC106605015 other downstream 1088468 43372725 ~ 43392160 (-)
G145767 NA other downstream 1208081 43270717 ~ 43272516 (-)
G145010 NA other downstream 1773318 42706818 ~ 42707279 (-)
G147800 NA other upstream 382131 44863085 ~ 44863559 (-)
tmem86a tmem86a other upstream 2363226 46844180 ~ 46921608 (-)
G150290 NA other upstream 2365198 46846152 ~ 46849616 (-)

Expression


G147266 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G147266 Expression in each Bioproject

Bar chart with 19 bars.
G147266 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network