G152618



Basic Information


Item Value
gene id G152618
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 48805952 ~ 48806203 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU174711
cttcttacggagccactccttagttgccctggctgtgtgtttcgggtcgttgtcatgctggaagacccagccacgacccatcttcaatgctcttactgagggaaggagattgttggccaagatctcgcgatacatggccccatccctccacccctcaaaacggtgcagtcgtcctgtcccttttgcagaaaagcatccccaaagattgatgtttccacctccatgcttcatgtttgggatggtgttcttggg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU174711 True 252 lncRNA 0.53 1 48805952 48806203
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118940428 NA coding downstream 94722 48701449 ~ 48711230 (-)
ptdss2 ptdss2 coding downstream 107958 48661451 ~ 48697994 (-)
th th coding downstream 245120 48537830 ~ 48560832 (-)
commd9 commd9 coding downstream 348694 48449143 ~ 48457258 (-)
nap1l4a LOC106560703 coding downstream 421140 48319220 ~ 48384812 (-)
trnas-gcu NA coding upstream 4149 48810352 ~ 48810433 (-)
trnas-gcu-2 NA coding upstream 5268 48809911 ~ 48812873 (-)
trnas-gcu-3 NA coding upstream 6386 48812589 ~ 48812670 (-)
ifitm5 LOC106560727 coding upstream 269890 49076093 ~ 49078840 (-)
cat cata coding upstream 296783 49102986 ~ 49114529 (-)
G152605 NA non-coding downstream 8144 48797541 ~ 48797808 (-)
G152596 NA non-coding downstream 11748 48793939 ~ 48794204 (-)
G152594 NA non-coding downstream 13871 48791752 ~ 48792081 (-)
G152542 NA non-coding downstream 46947 48758783 ~ 48759005 (-)
G152356 NA non-coding downstream 144914 48659223 ~ 48661038 (-)
G152833 NA non-coding upstream 173188 48979391 ~ 48979626 (-)
G152895 NA non-coding upstream 236823 49043026 ~ 49043255 (-)
G153535 NA non-coding upstream 405399 49211602 ~ 49211822 (-)
G153538 NA non-coding upstream 413104 49219307 ~ 49219528 (-)
G152024 NA other downstream 502289 48303311 ~ 48303663 (-)
G151920 NA other downstream 579008 48226299 ~ 48226944 (-)
G151875 NA other downstream 617674 48187958 ~ 48188278 (-)
G151474 NA other downstream 954604 47850785 ~ 47851348 (-)
G150675 LOC100653436 other downstream 1600519 47194893 ~ 47205433 (-)
G154300 NA other upstream 1295227 50101430 ~ 50107447 (-)
G154338 NA other upstream 1350483 50156686 ~ 50157825 (-)
G155003 NA other upstream 1609540 50415743 ~ 50452147 (-)
G155072 NA other upstream 1773595 50579798 ~ 50581349 (-)
G155281 LOC106560681 other upstream 2164873 50971076 ~ 50971935 (-)

Expression


G152618 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G152618 Expression in each Bioproject

Bar chart with 17 bars.
G152618 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network