G153406



Basic Information


Item Value
gene id G153406
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 49799002 ~ 49819182 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU175551
gcgatattttgtcacgaaaagatgctcgactatgcatattcttgacagttttggaaagaaaacactctgaagtttcagaatctgcaaagattttgtctgtaagtgccccagaactcattctacaggcgaaaccaagatgatgcatcacccaggaattagcagaatttctgaagctctgttttccattctctccttatatggctgtgattgcgcaacgaatgagcctacactttctgtcgttcgcccaaggtcttagcagcattgtgacgtatttgtaggcatatcattggaagattgaccataagagactacattttccagaggtccgcccggtgtcctttgtctaaatttgtgcgtaatcttcaggtgcgggcattttctcctgggattcaggagagaaagcatgtgtccaagaacgatgtatcaatgaagagatatgtgaaaaacaccttgaggattgattctaaacaacgtttgccatgttttcagtcgatattatggagttaatttggaaaaaagtttgcgttttgaggactgaatttatggattttttttggtagccaaatgtgatgtataaaacggagctatttctaatacacaaggaatctttttggaaaaactgagcatctgctatctaactgagagtatcctcattgaaaacatcagaagttcttcaaaggtaaatgattttatttgaagaacttctgatgttttcaatgaggatactctcagttagatagcagatgctcagtttttccaaaaagattccttgtgtattagaaatagctccgttttatacatcacatttggctaccaaaaaaaatctgaaaattcagtcctcaaaacgcgaacttttttccaaatgaactccataatatcgactgaaaacatggcaaacgttgtttagaatcaatcatcaaggtgtttttcacatatctcttcattgatacatcgttcttggacacatgctttctcccctgaatcaaatggtaaagtagaagcagctggcaattgcgcaccgaattcgacgcaggacaccaggcggacacttggaaaatgtagtctcttatggtcaatcttccaatgatatgcctacaaatacgtcaatgctgctaagaccttgggcgaccgacagaaagtgtaggctcattcgttgcgcaatcacagccatataaggagagaatggaaaacagagcttcagaaattctgctaattcctgggtgatgcatcatcttggtttcgcctgtagaatgagttctggggcacttacagacaaaatctttgcagattctgaaacttcatagtgttttctttccaaaactgtcaagaat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU175551 True 1331 lncRNA 0.39 2 49799002 49819182
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490948 LOC106560694 coding upstream 31877 49749113 ~ 49767125 (+)
cdkn1cb LOC106560698 coding upstream 1060451 48736519 ~ 48738551 (+)
prr5l prr5l coding upstream 1297122 48481528 ~ 48501880 (+)
fcsk fuk coding upstream 1351215 48394983 ~ 48447787 (+)
LOC110491010 LOC106560692 coding downstream 249027 50068209 ~ 50093310 (+)
LOC110491026 LOC106560691 coding downstream 279205 50098387 ~ 50100624 (+)
LOC110491039 LOC106560690 coding downstream 331279 50150461 ~ 50159171 (+)
LOC110491040 LOC106560688 coding downstream 362118 50181300 ~ 50198685 (+)
LOC110491046 LOC106560687 coding downstream 404556 50223738 ~ 50236226 (+)
G153403 NA non-coding upstream 4294 49794464 ~ 49794708 (+)
G153394 NA non-coding upstream 19403 49779391 ~ 49779599 (+)
G153393 NA non-coding upstream 21302 49777471 ~ 49777700 (+)
G153391 NA non-coding upstream 23461 49775296 ~ 49775541 (+)
G153373 NA non-coding upstream 30147 49742171 ~ 49768855 (+)
G153425 NA non-coding downstream 27036 49846218 ~ 49846496 (+)
G153431 NA non-coding downstream 37785 49856967 ~ 49857178 (+)
G153433 NA non-coding downstream 40397 49859579 ~ 49859799 (+)
G153928 NA non-coding downstream 73255 49892437 ~ 49892731 (+)
G153942 NA non-coding downstream 82279 49901461 ~ 49901692 (+)
G152167 NA other upstream 1241316 48556782 ~ 48557686 (+)
G150997 NA other upstream 2251423 47497948 ~ 47547579 (+)
uevld uevld other upstream 2813776 46981686 ~ 47007672 (+)
G148191 NA other upstream 4306623 45472082 ~ 45492379 (+)
G147510 NA other upstream 4927502 44870800 ~ 44871500 (+)
G154859 NA other downstream 1346233 51165415 ~ 51167174 (+)
LOC110501653 LOC106560673 other downstream 1502614 51317121 ~ 51339537 (+)
rl28 rl28 other downstream 1593084 51412121 ~ 51417154 (+)
G155541 NA other downstream 1601665 51420847 ~ 51421122 (+)

Expression


G153406 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G153406 Expression in each Bioproject

Bar chart with 18 bars.
G153406 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network