G153957



Basic Information


Item Value
gene id G153957
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 49911230 ~ 49911516 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU176137
aatacatatatcactagccactttaactatgccactttgtttacatactcatctcatatgtatatactgtacttgatacctgctgctctgtaccatcactcatttatatatccttatgtacatattctttatccccttacactgtgtacaagacagtagttttggaattgttagttagagtacttgttattactgcattgtcggaactagaagcacaagcatttcgctacactcgcattaacatctgctaaccatgtgtatgtgacaaataaaatttgatttgattt

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU176137 True 287 lncRNA 0.41 1 49911230 49911516

Neighbor


gene id symbol gene type direction distance location
LOC110490968 LOC105006464 coding downstream 74183 49801952 ~ 49837047 (-)
LOC118936760 NA coding downstream 171984 49738842 ~ 49739246 (-)
hmg20a hmg20a coding downstream 435859 49451688 ~ 49475371 (-)
peak1 peak1 coding downstream 483947 49166669 ~ 49427283 (-)
syt12 syt12 coding downstream 755969 49114742 ~ 49155261 (-)
LOC110490984 LOC106560693 coding upstream 51380 49962896 ~ 50037892 (-)
plscr3a LOC106560726 coding upstream 213045 50124561 ~ 50127403 (-)
LOC118937274 NA coding upstream 217999 50129515 ~ 50131269 (-)
LOC110491057 LOC100136935 coding upstream 360702 50272218 ~ 50287727 (-)
LOC110491068 larp1 coding upstream 563116 50474632 ~ 50561307 (-)
G153949 NA non-coding downstream 4073 49906831 ~ 49907157 (-)
G153936 NA non-coding downstream 13017 49897967 ~ 49898213 (-)
G153916 NA non-coding downstream 29375 49881570 ~ 49881855 (-)
G153909 NA non-coding downstream 37271 49873724 ~ 49873959 (-)
G153903 NA non-coding downstream 47053 49863971 ~ 49864177 (-)
G153958 NA non-coding upstream 55 49911571 ~ 49911992 (-)
G153988 NA non-coding upstream 27781 49939297 ~ 49939747 (-)
G154241 NA non-coding upstream 66092 49977608 ~ 49977818 (-)
G154249 NA non-coding upstream 73229 49984745 ~ 49985009 (-)
G154271 LOC105007919 non-coding upstream 179660 50091176 ~ 50093305 (-)
G152024 NA other downstream 1607567 48303311 ~ 48303663 (-)
G151920 NA other downstream 1684286 48226299 ~ 48226944 (-)
G151875 NA other downstream 1722952 48187958 ~ 48188278 (-)
G151474 NA other downstream 2059882 47850785 ~ 47851348 (-)
G150675 LOC100653436 other downstream 2705797 47194893 ~ 47205433 (-)
G154300 NA other upstream 189914 50101430 ~ 50107447 (-)
G154338 NA other upstream 245170 50156686 ~ 50157825 (-)
G155003 NA other upstream 504227 50415743 ~ 50452147 (-)
G155072 NA other upstream 668282 50579798 ~ 50581349 (-)
G155281 LOC106560681 other upstream 1059560 50971076 ~ 50971935 (-)

Expression



Co-expression Network