G155515


Basic Information

Item Value
gene id G155515
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 51350626 ~ 51355466 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU177876
gtcttgtttctgtcctttctcttcaccctgtctccctctgctggtcgtattaggttaccttttcttcccctctttcccccagctgttccttgtcttctctgactacctcgttcaccccttttcccacctgttccctttttccctctgattaggtctctatatctctctctgtttttgcttctgtctttgtcggattctcgtttgtgttactc

Function

NR:

description
PREDICTED: NACHT, LRR and PYD domains-containing protein 3-like isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU177876 True 212 lncRNA 0.47 2 51350626 51355466

Neighbor

gene id symbol gene type direction distance location
LOC110501653 LOC106560673 coding upstream 11089 51317121 ~ 51339537 (+)
LOC110491302 LOC106560674 coding upstream 55880 51247741 ~ 51294746 (+)
LOC110491287 LOC106602850 coding upstream 114067 51233705 ~ 51236559 (+)
LOC110491269 LOC106560677 coding upstream 213726 51114207 ~ 51136900 (+)
LOC118944166 NA coding upstream 255779 51094723 ~ 51094847 (+)
LOC110491314 LOC106560671 coding downstream 19858 51375324 ~ 51405615 (+)
rl28 rl28 coding downstream 56655 51412121 ~ 51417154 (+)
LOC118944199 NA coding downstream 66390 51421856 ~ 51422029 (+)
LOC118944142 NA coding downstream 66871 51422337 ~ 51422453 (+)
LOC118944140 NA coding downstream 73988 51429454 ~ 51429572 (+)
G154901 NA non-coding upstream 50772 51294802 ~ 51299854 (+)
G154817 NA non-coding upstream 202729 51145536 ~ 51147897 (+)
G154837 NA non-coding upstream 238851 51111535 ~ 51111775 (+)
G154836 NA non-coding upstream 241552 51108800 ~ 51109074 (+)
G154829 NA non-coding upstream 252185 51098221 ~ 51098441 (+)
G155489 NA non-coding downstream 32511 51387977 ~ 51400214 (+)
G155491 NA non-coding downstream 54871 51410337 ~ 51410863 (+)
G155492 NA non-coding downstream 75400 51430866 ~ 51501997 (+)
G155845 NA non-coding downstream 237376 51592842 ~ 51593164 (+)
G155940 LOC106613263 non-coding downstream 372055 51727521 ~ 51835110 (+)
G154859 NA other upstream 183452 51165415 ~ 51167174 (+)
LOC110491026 LOC106560691 other upstream 1250152 50098387 ~ 50100624 (+)
G152167 NA other upstream 2792940 48556782 ~ 48557686 (+)
G150997 NA other upstream 3803047 47497948 ~ 47547579 (+)
G155541 NA other downstream 65381 51420847 ~ 51421122 (+)
G156000 LOC106560791 other downstream 461044 51816510 ~ 51824182 (+)
G158778 LOC106560766 other downstream 2666142 54021608 ~ 54021904 (+)
G159415 NA other downstream 2997517 54352983 ~ 54353388 (+)

Expression


Co-expression Network