G159343



Basic Information


Item Value
gene id G159343
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 54291905 ~ 54292247 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU181891
tttgacattcttcaaagtagccaccctttgccttgatgacaggtttgcacactcttggcatttgcttatccagcttcatgaggaagtcacctggaatgcatttcaattaacaggtgtgcattaaaagttaatttgtggaatttctttccttcttaatgtgtttgagccaatcggttgtgctgtaacaaggtaggggggcatacagaagatagccctatttggtaaaagaccaagtccatattatggcaaaaacagctcaaataagcaaagagaaacgacagtccatcattactttaagacatgaaggtcagtcaatccagaaaatgtcaataactttgaaagt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU181891 True 343 lncRNA 0.80 1 54291905 54292247
Loading

Neighbor


gene id symbol gene type direction distance location
ambra1b LOC106560763 coding downstream 23511 54213602 ~ 54268394 (-)
chrm4b LOC106560739 coding downstream 80949 54209058 ~ 54210956 (-)
phf21ab LOC106560766 coding downstream 233749 53996094 ~ 54058156 (-)
prdm11 LOC106560765 coding downstream 296327 53977928 ~ 53995578 (-)
cd59 cd59-2 coding downstream 320538 53969443 ~ 53971367 (-)
coro2bb coro2b coding upstream 11118 54303365 ~ 54339835 (-)
fem1b fem1b coding upstream 166418 54458665 ~ 54462837 (-)
LOC110491804 LOC106560756 coding upstream 228895 54510925 ~ 54525000 (-)
ciao2a fam96a coding upstream 555345 54847592 ~ 54852144 (-)
si:ch211-284k5.2 LOC106560792 coding upstream 686670 54978917 ~ 55001034 (-)
G159342 NA non-coding downstream 69 54291591 ~ 54291836 (-)
G159298 NA non-coding downstream 63332 54200881 ~ 54228573 (-)
G159292 NA non-coding downstream 98342 54192843 ~ 54193563 (-)
G159290 LOC106560764 non-coding downstream 105695 54185108 ~ 54186210 (-)
G159344 NA non-coding upstream 1661 54293908 ~ 54294120 (-)
nox5 nox5 non-coding upstream 5814 54281716 ~ 54298946 (-)
G159353 NA non-coding upstream 9308 54301555 ~ 54301770 (-)
G159408 NA non-coding upstream 52366 54344613 ~ 54344852 (-)
G159418 NA non-coding upstream 62028 54354275 ~ 54354496 (-)
G159120 NA other downstream 434353 53856686 ~ 53857552 (-)
snx33 snx33 other downstream 1179614 53032902 ~ 53112547 (-)
G155610 NA other downstream 2874795 51412269 ~ 51417110 (-)
G159890 LOC106562215 other upstream 436052 54728299 ~ 54728860 (-)
LOC110491905 ppip5k1 other upstream 1643424 55935649 ~ 56006747 (-)
G161823 NA other upstream 2009108 56301355 ~ 56302095 (-)
G162657 NA other upstream 2535049 56827296 ~ 56830576 (-)
G162745 NA other upstream 2822320 57114567 ~ 57117150 (-)

Expression


G159343 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G159343 Expression in each Bioproject

Bar chart with 20 bars.
G159343 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network