G161667 (pdia3)


Basic Information

Item Value
gene id G161667
gene name pdia3
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 56200106 ~ 56200510 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU184396
ATGAAGATCAAGGTGTAACACAGACGGGACTTGTTTGACATGTAGGTCCTGTGTGTGTCAAGTACTTTCCAAATAGTTCTGACTTGGAAGACTTATCACTCACCCCCTGACTTCGTATTGAGATGGGACATCATTGGCTGTGGCGTCCATCTTTGCGATGACAATGTTGGGATCACTGGACAGCTTCTCTCCCAGCTCTTTCCACTTGGGCTCCAGGCTCTTGCAGTGGCCGCACCACGGGGCGTAGAACTCAATCAGCACGTCCTTTTCCTCGTTGTTCACAATGGCGTCAAAGTTCTCAGCCACCACAGTCTG

Function

symbol description
pdia3 Predicted to enable protein disulfide isomerase activity. Predicted to be involved in protein folding and response to endoplasmic reticulum stress. Predicted to be located in endoplasmic reticulum lumen. Predicted to be active in cell surface and endoplasmic reticulum. Is expressed in several structures, including axis; hatching gland; hypochord; nervous system; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in autoimmune hepatitis. Orthologous to human PDIA3 (protein disulfide isomerase family A member 3).

NR:

description
protein disulfide isomerase family A, member 3, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU184396 True 315 lncRNA 0.50 2 56200106 56200510

Neighbor

gene id symbol gene type direction distance location
LOC110491996 LOC106561096 coding upstream 29142 56146461 ~ 56170964 (+)
acanb LOC106561101 coding upstream 143726 56032490 ~ 56056380 (+)
LOC110491898 map1a coding upstream 268522 55861422 ~ 55931584 (+)
scamp2 scamp2 coding upstream 342806 55841445 ~ 55857300 (+)
myo9ab LOC106560748 coding upstream 380588 55592661 ~ 55819518 (+)
LOC110492043 catsper2 coding downstream 7318 56207828 ~ 56229077 (+)
LOC110492132 LOC106561087 coding downstream 286187 56486697 ~ 56497109 (+)
LOC110492152 LOC106584663 coding downstream 307126 56507636 ~ 56518535 (+)
LOC110492171 LOC106561080 coding downstream 368064 56568574 ~ 56620288 (+)
LOC110492185 LOC106561079 coding downstream 420929 56621439 ~ 56633187 (+)
G161663 i20l1 non-coding upstream 2670 56196310 ~ 56197436 (+)
G161662 NA non-coding upstream 5432 56193694 ~ 56194674 (+)
G161594 NA non-coding upstream 68442 56130983 ~ 56131664 (+)
G161559 NA non-coding upstream 110037 56089819 ~ 56090069 (+)
G161494 NA non-coding upstream 168193 56031708 ~ 56031913 (+)
G161668 NA non-coding downstream 12 56200522 ~ 56201620 (+)
G161715 NA non-coding downstream 87305 56287815 ~ 56288182 (+)
G161716 NA non-coding downstream 88442 56288952 ~ 56289283 (+)
G161722 NA non-coding downstream 96341 56296851 ~ 56297082 (+)
G161724 NA non-coding downstream 98574 56299084 ~ 56299404 (+)
G160569 NA other upstream 252861 55946143 ~ 55947245 (+)
G159889 LOC106562215 other upstream 1471246 54728296 ~ 54728860 (+)
G159415 NA other upstream 1846718 54352983 ~ 54353388 (+)
G158778 LOC106560766 other upstream 2178202 54021608 ~ 54021904 (+)
G156000 LOC106560791 other upstream 4375924 51816510 ~ 51824182 (+)
G161687 NA other downstream 44534 56245044 ~ 56252598 (+)
G162130 NA other downstream 847804 57048314 ~ 57053642 (+)
G163513 LOC106561046 other downstream 1727640 57928150 ~ 57931991 (+)
G163660 LOC106561040 other downstream 2015167 58215677 ~ 58216383 (+)
G166131 lmod2 other downstream 3745198 59945708 ~ 59953165 (+)

Expression


Co-expression Network