G166944



Basic Information


Item Value
gene id G166944
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 60566110 ~ 60566410 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU190203
attagatactttgtcatgcattttctgaatcaaacgcgccaaataaatggacaatttggagatataacgacggaattaacttctctagggtagggggcagcattcagaattttggatgaaaagcatgcccaaattaaatggcctgctactcaggcccagaagatatgatatgcatatatggcaggcgaaaacctgagaaaaatccattcaggaagtagttttctttttggttttgtagttttctattcaatgccattacagtatccattgacttaggactcaaattgcagttcccatgcct

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU190203 True 301 lncRNA 0.38 1 60566110 60566410
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110492890 LOC106561126 coding downstream 6364 60537619 ~ 60559746 (-)
ppp1r3ab LOC106561019 coding downstream 95552 60448878 ~ 60470558 (-)
LOC110492857 LOC106561020 coding downstream 128550 60419131 ~ 60437560 (-)
ptprz1a ptprz1 coding downstream 193468 60293012 ~ 60372642 (-)
LOC110492814 asb15 coding downstream 602961 59951992 ~ 59963149 (-)
LOC110492911 LOC106561018 coding upstream 58732 60625142 ~ 60627473 (-)
LOC110493006 LOC106561012 coding upstream 268747 60835157 ~ 60850563 (-)
LOC110493125 myod1c coding upstream 314986 60881396 ~ 60883242 (-)
zgc:172145 LOC106561011 coding upstream 322383 60888793 ~ 60899520 (-)
LOC110493151 LOC106561010 coding upstream 477843 61044253 ~ 61059973 (-)
G166935 NA non-coding downstream 7299 60558561 ~ 60558811 (-)
G166931 NA non-coding downstream 11398 60554496 ~ 60554712 (-)
G166889 NA non-coding downstream 42196 60523708 ~ 60523914 (-)
G166882 NA non-coding downstream 48372 60517538 ~ 60517738 (-)
G166946 NA non-coding upstream 434 60566844 ~ 60567189 (-)
G166952 NA non-coding upstream 2572 60568982 ~ 60569187 (-)
G166980 NA non-coding upstream 21413 60587823 ~ 60588047 (-)
G167006 NA non-coding upstream 39861 60606271 ~ 60606672 (-)
G167008 NA non-coding upstream 40566 60606976 ~ 60607198 (-)
G166877 LOC106613263 other downstream 50588 60515226 ~ 60515522 (-)
G166794 LOC106561021 other downstream 159302 60402348 ~ 60406808 (-)
G166541 NA other downstream 645780 59919878 ~ 59920330 (-)
LOC110492782 LOC106561029 other downstream 736095 59826624 ~ 59841614 (-)
G167723 NA other upstream 112313 60678723 ~ 60679041 (-)
G167706 LOC106561017 other upstream 169561 60695263 ~ 60740351 (-)
G167866 NA other upstream 408352 60974762 ~ 60975021 (-)
G168021 NA other upstream 688102 61254512 ~ 61256015 (-)
LOC110493186 mlkl other upstream 724729 61290149 ~ 61303507 (-)

Expression


G166944 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G166944 Expression in each Bioproject

Bar chart with 13 bars.
G166944 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network