G173431



Basic Information


Item Value
gene id G173431
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 65921850 ~ 65922229 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU197229
gatgagctaaacaacttctatgctcgctttgaggcaagcaacactgaagcatgcatgagagcatcagctgttccagacaactttgtgatcacgctctccgtagccgatgtaagacctttaaacaggtcaacattcacaaggccagacggattaccaggacgtgtactccgagcatgcgctgaccaactggcaagtgtcttcactgacattttcaacctgtctctgactgagtctgtaataccaacatgtttcaagcagaccaccatagtccctgtgcccaagaacaccacggtaacctgcctaaatgactaccgacctgtagcactcacatctgtagccatgaagttctttgacaggatggtcatggctcacaacaacac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU197229 True 380 TUCP 0.40 1 65921850 65922229
Loading

Neighbor


gene id symbol gene type direction distance location
usb1 usb1 coding downstream 92110 65821657 ~ 65829740 (-)
ccdc135 drc7 coding downstream 129053 65782330 ~ 65792797 (-)
LOC110493917 LOC106560931 coding downstream 143334 65762721 ~ 65778516 (-)
LOC110493906 ca5a coding downstream 169805 65730731 ~ 65752045 (-)
slc7a5 slc7a5 coding downstream 205893 65685261 ~ 65715957 (-)
snrkb LOC106560921 coding upstream 109794 66032023 ~ 66069982 (-)
znrf1 znrf1 coding upstream 161997 66084226 ~ 66118713 (-)
LOC110494064 NA coding upstream 222617 66144846 ~ 66146269 (-)
si:dkeyp-50b9.1 LOC106560918 coding upstream 288207 66210436 ~ 66223350 (-)
LOC110494122 LOC106560915 coding upstream 375959 66277821 ~ 66299637 (-)
G173429 NA non-coding downstream 1591 65919998 ~ 65920259 (-)
G173428 NA non-coding downstream 4449 65915063 ~ 65917401 (-)
G173401 NA non-coding downstream 38430 65882437 ~ 65883420 (-)
G173393 NA non-coding downstream 43905 65875214 ~ 65877945 (-)
G173349 NA non-coding downstream 118500 65799892 ~ 65803350 (-)
G173436 NA non-coding upstream 8328 65930557 ~ 65930764 (-)
G173448 NA non-coding upstream 28993 65951222 ~ 65972057 (-)
G173488 NA non-coding upstream 77146 65999375 ~ 66029700 (-)
G173569 NA non-coding upstream 219374 66141603 ~ 66141803 (-)
G173577 NA non-coding upstream 223375 66145604 ~ 66149000 (-)
G173370 LOC106560927 other downstream 82776 65833341 ~ 65839074 (-)
zcchc14 zcchc14 other downstream 385069 65530911 ~ 65571025 (-)
G173121 NA other downstream 537977 65383437 ~ 65383873 (-)
G172141 NA other downstream 835662 65085572 ~ 65086188 (-)
tmem117 LOC106573612 other downstream 1753452 64102056 ~ 64170220 (-)
G173675 NA other upstream 413183 66335412 ~ 66338386 (-)
G173696 LOC106560906 other upstream 452997 66375226 ~ 66390766 (-)
G174505 NA other upstream 770179 66692408 ~ 66692850 (-)
G177487 NA other upstream 3668906 69591135 ~ 69591722 (-)

Expression


G173431 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G173431 Expression in each Bioproject

Bar chart with 20 bars.
G173431 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network