G173808



Basic Information


Item Value
gene id G173808
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 66533458 ~ 66533659 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU197660
tcagtttggatggggagcatcactgcacagctattctcaggtctctccagaaatgtccgatcgggttgaagtccaggctctggctgggccactcaaggacatacagagacttgtccctaggccactcctgcattgtcttggctgtatgcttagggtcattgtcctgttggaaggtgtcccttcgccccagtctgaggtcctg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU197660 True 202 lncRNA 0.54 1 66533458 66533659
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110494260 LOC106560901 coding upstream 3897 66508242 ~ 66529561 (+)
LOC110494252 LOC106560900 coding upstream 25468 66496959 ~ 66507990 (+)
LOC110494247 LOC106560903 coding upstream 38376 66473806 ~ 66495082 (+)
adat1 adat1 coding upstream 72581 66434480 ~ 66460877 (+)
LOC110494212 LOC106560906 coding upstream 111121 66375132 ~ 66422337 (+)
LOC110494278 chmp1a coding downstream 4296 66537955 ~ 66547328 (+)
LOC110494286 LOC106560898 coding downstream 15886 66549545 ~ 66552357 (+)
LOC110494295 fanca coding downstream 21888 66555547 ~ 66581651 (+)
vps9d1 LOC106560896 coding downstream 52740 66586399 ~ 66611590 (+)
LOC110494358 LOC106560893 coding downstream 123185 66656844 ~ 66665610 (+)
G173806 NA non-coding upstream 1571 66531666 ~ 66531887 (+)
G173805 NA non-coding upstream 2748 66530452 ~ 66530710 (+)
G173804 NA non-coding upstream 3120 66530115 ~ 66530338 (+)
LOC110494202 polr2c non-coding upstream 169988 66359803 ~ 66363985 (+)
LOC110494008 LOC106560923 non-coding upstream 533894 65975745 ~ 66031253 (+)
G173835 NA non-coding downstream 1555 66535214 ~ 66535447 (+)
G173843 NA non-coding downstream 78985 66612644 ~ 66614161 (+)
G173844 NA non-coding downstream 80714 66614373 ~ 66615201 (+)
G173840 NA non-coding downstream 81706 66615365 ~ 66617682 (+)
G173868 NA non-coding downstream 87381 66621040 ~ 66621275 (+)
LOC110494096 LOC106561115 other upstream 267435 66262594 ~ 66266024 (+)
G172639 NA other upstream 597325 65935596 ~ 65936133 (+)
jph3 jph3 other upstream 892482 65593468 ~ 65648660 (+)
map1lc3b map1lc3b other upstream 996671 65531126 ~ 65536787 (+)
G170150 LOC106560975 other upstream 2655225 63873248 ~ 63878233 (+)
G173938 LOC106573687 other downstream 208161 66741820 ~ 66742213 (+)
LOC110494451 zfpm1 other downstream 421865 66900017 ~ 66995521 (+)
LOC110494472 utp4 other downstream 705231 67232278 ~ 67239902 (+)
hsbp1b LOC106561110 other downstream 952504 67486128 ~ 67488205 (+)
G176612 LOC100846954 other downstream 2327179 68860838 ~ 68861368 (+)

Expression


G173808 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G173808 Expression in each Bioproject

Bar chart with 13 bars.
G173808 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network