G174268



Basic Information


Item Value
gene id G174268
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 67256953 ~ 67257215 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU198173
aaaacgcatgtcaaaaatgttagaaattgatttgcattttaatgagggaaataagtatttgaccccctctcaatcagaaagatttctggctcccaggagtgctcctaatctcagcttgttacctgtataaaagacacctgtccacagaagcaatcaatcatattccaaactctccaccatggccaagaccaaagagctctccaaggatgtcagggacaggattgtagacctacacaaggctggaatgggctacaagaccatcg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU198173 True 263 lncRNA 0.43 1 67256953 67257215
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110494472 utp4 coding upstream 17051 67232278 ~ 67239902 (+)
has3 has3 coding upstream 26735 67216792 ~ 67230218 (+)
tango6 tango6 coding upstream 42605 67181100 ~ 67214348 (+)
il17c2 il17c2 coding upstream 76194 67177661 ~ 67180759 (+)
LOC110494462 zc3h18 coding upstream 80431 67135942 ~ 67176522 (+)
hsbp1b LOC106561110 coding downstream 228913 67486128 ~ 67488205 (+)
LOC110494554 LOC106560874 coding downstream 267195 67524410 ~ 67536975 (+)
LOC110501822 znf423 coding downstream 1146444 68403659 ~ 68551466 (+)
si:ch211-212o1.2 LOC106560866 coding downstream 1296539 68553754 ~ 68592859 (+)
cbln1 cbln1 coding downstream 1388260 68645475 ~ 68653500 (+)
G174254 NA non-coding upstream 20774 67235572 ~ 67236179 (+)
G174244 NA non-coding upstream 42066 67214653 ~ 67214887 (+)
G174155 NA non-coding upstream 168894 67087793 ~ 67088059 (+)
G174273 NA non-coding downstream 5960 67263175 ~ 67263455 (+)
G174319 NA non-coding downstream 96863 67354078 ~ 67354509 (+)
G174327 NA non-coding downstream 110939 67368154 ~ 67402620 (+)
G174377 NA non-coding downstream 201341 67458556 ~ 67461685 (+)
G175062 NA non-coding downstream 301748 67558963 ~ 67559195 (+)
LOC110494451 zfpm1 other upstream 284498 66900017 ~ 66995521 (+)
G173938 LOC106573687 other upstream 514740 66741820 ~ 66742213 (+)
LOC110494096 LOC106561115 other upstream 990930 66262594 ~ 66266024 (+)
G172639 NA other upstream 1320820 65935596 ~ 65936133 (+)
G176612 LOC100846954 other downstream 1603623 68860838 ~ 68861368 (+)
G176725 lonp2 other downstream 1699048 68956263 ~ 68957886 (+)
G177067 NA other downstream 2199343 69456558 ~ 69457433 (+)
G177812 NA other downstream 2850071 70107286 ~ 70113440 (+)

Expression


G174268 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G174268 Expression in each Bioproject

Bar chart with 19 bars.
G174268 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network