G180901



Basic Information


Item Value
gene id G180901
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 72321926 ~ 72322148 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU205374
GCTCGGTAGTTTGAACTCAAGGTAAGTAACCATTTATATTTCATACCACAGCAACTGAATCAACATAGACTCTGAAACAATGATCCAACATACTGCTACTTTTCAGACATGGGATTCTCAGCAACTCAGCTTTCACTGTAGAAATAACATCTTAACATTTCAAACAAATACAATACCAAAGCATTTCAAGTGAACTTTCAATAACAAGTTTACAGTCTGGAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU205374 True 223 lncRNA 0.35 1 72321926 72322148

Neighbor


gene id symbol gene type direction distance location
LOC110533853 LOC106561194 coding upstream 68117 72250884 ~ 72253809 (+)
LOC110495604 LOC106573778 coding upstream 256727 72059717 ~ 72065199 (+)
LOC110495562 LOC106561144 coding upstream 313663 71995694 ~ 72008263 (+)
LOC118937292 NA coding upstream 339105 71961719 ~ 71982821 (+)
LOC118941481 NA coding upstream 361827 71944685 ~ 71960099 (+)
LOC110495632 LOC106561195 coding downstream 14654 72336802 ~ 72343356 (+)
tln2b LOC106561152 coding downstream 566169 72888317 ~ 73030225 (+)
LOC110495666 LOC106573503 coding downstream 733980 73056128 ~ 73069598 (+)
lactb LOC106561153 coding downstream 750269 73072417 ~ 73075269 (+)
tmem266 LOC106561154 coding downstream 762141 73084289 ~ 73146123 (+)
G180895 NA non-coding upstream 5941 72315677 ~ 72315985 (+)
G180893 NA non-coding upstream 8312 72313336 ~ 72313614 (+)
G180865 NA non-coding upstream 33685 72288016 ~ 72288241 (+)
G180855 NA non-coding upstream 42397 72279203 ~ 72279529 (+)
G180844 NA non-coding upstream 50606 72270993 ~ 72271320 (+)
G180902 NA non-coding downstream 395 72322543 ~ 72322781 (+)
G180903 NA non-coding downstream 1082 72323230 ~ 72323510 (+)
G180943 NA non-coding downstream 26163 72348311 ~ 72348675 (+)
G180945 NA non-coding downstream 27697 72349845 ~ 72351306 (+)
G180986 NA non-coding downstream 56990 72379138 ~ 72379344 (+)
igf1ra igf1r other upstream 1514022 70794530 ~ 70905277 (+)
G177812 NA other upstream 2208486 70107286 ~ 70113440 (+)
G177067 NA other upstream 2864493 69456558 ~ 69457433 (+)
G181995 NA other downstream 1019232 73341380 ~ 73342277 (+)
LOC110501876 LOC106561170 other downstream 1254617 73456669 ~ 73580075 (+)
G182139 LOC106561173 other downstream 1284744 73606892 ~ 73610237 (+)
G182144 NA other downstream 1300388 73622536 ~ 73624518 (+)
G183361 NA other downstream 2207501 74529649 ~ 74535026 (+)

Expression


G180901 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G180901 Expression in each Bioproject

Bar chart with 13 bars.
G180901 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network