G181854



Basic Information


Item Value
gene id G181854
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 73132159 ~ 73132598 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU206373
GTGACGGGTCCAGGACCTGGGGCTGTGACCTCTCCTCTATAATATCAGCATTATTAGTATTCCTCAGTAAACAGTGACAGGTCCAGGACCTGGGGCTGTGACCTCTCCTCTATAATATCAGCATTATTAGTATTCCTCAGTAAACAGTGACAGGTCCAGGACCTGGGGCTGTGACCTCTCCTCTATAATATCAGCATCATTAGTATTCC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU206373 True 209 lncRNA 0.47 3 73132159 73132598
Loading

Neighbor


gene id symbol gene type direction distance location
lactb LOC106561153 coding upstream 56890 73072417 ~ 73075269 (+)
LOC110495666 LOC106573503 coding upstream 62561 73056128 ~ 73069598 (+)
tln2b LOC106561152 coding upstream 101934 72888317 ~ 73030225 (+)
LOC110495632 LOC106561195 coding upstream 788803 72336802 ~ 72343356 (+)
LOC110533853 LOC106561194 coding upstream 878350 72250884 ~ 72253809 (+)
isl2a LOC106561155 coding downstream 31161 73163759 ~ 73169203 (+)
LOC110495782 LOC106561158 coding downstream 166982 73299580 ~ 73316950 (+)
si:dkey-24l11.2 LOC106561161 coding downstream 219202 73351800 ~ 73361169 (+)
LOC110495809 LOC106561197 coding downstream 228711 73361309 ~ 73362530 (+)
LOC110495840 LOC106561167 coding downstream 267661 73400259 ~ 73405787 (+)
G181833 NA non-coding upstream 36945 73093953 ~ 73095214 (+)
G181706 NA non-coding upstream 196727 72887273 ~ 72935432 (+)
G181601 NA non-coding upstream 324984 72806900 ~ 72807175 (+)
G181600 NA non-coding upstream 325459 72806371 ~ 72806700 (+)
G181040 NA non-coding upstream 668947 72456880 ~ 72463212 (+)
G181859 NA non-coding downstream 4189 73136787 ~ 73407337 (+)
G181887 NA non-coding downstream 60749 73193347 ~ 73194365 (+)
G181930 LOC106561156 non-coding downstream 112297 73244895 ~ 73273032 (+)
G181948 NA non-coding downstream 136429 73269027 ~ 73296683 (+)
G181989 LOC107750509 non-coding downstream 194864 73327462 ~ 73328861 (+)
LOC110495604 LOC106573778 other upstream 1066964 72059717 ~ 72065199 (+)
igf1ra igf1r other upstream 2324255 70794530 ~ 70905277 (+)
G177812 NA other upstream 3018719 70107286 ~ 70113440 (+)
G177067 NA other upstream 3674726 69456558 ~ 69457433 (+)
G181995 NA other downstream 208782 73341380 ~ 73342277 (+)
LOC110501876 LOC106561170 other downstream 444167 73456669 ~ 73580075 (+)
G182139 LOC106561173 other downstream 474294 73606892 ~ 73610237 (+)
G182144 NA other downstream 489938 73622536 ~ 73624518 (+)
G183361 NA other downstream 1397051 74529649 ~ 74535026 (+)

Expression


G181854 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G181854 Expression in each Bioproject

Bar chart with 6 bars.
G181854 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network