G181994



Basic Information


Item Value
gene id G181994
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 73339463 ~ 73340072 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU206529
attaagaagaaaggcaacaccgccacagtgataaagcaaagagaaaaagcgtggcaaagtattgcagaccgcctgaatgcgtaagtagtgcacaattacacactcaccgctccgctgaaacatcacaattacaattcaaatatttaattcacatctccaaaaatgcagttgtactgtaattatgaaacggttaattttttttattgaaatgcactgcagatatgagtgaaattgtgtaaagtaactccatcacactgtataaagctatgataaaatttttgatatttttactgaaaacaagacaaaaataccaagtaattttttgcagtgtgactccattaagtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtagattaaacatgaacgggccaaaacggacatggcagcaggtcaaaatcaaatacaagaacattctgcagaatgcagtgaaaaagaatacccacagacaaggcacgggtggtgggtcaccaaaggctgaccttaccccagcagaggac

Function


NR:

description
uncharacterized protein LOC110536099 isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU206529 True 523 lncRNA 0.39 2 73339463 73340072

Neighbor


gene id symbol gene type direction distance location
LOC110495782 LOC106561158 coding upstream 22513 73299580 ~ 73316950 (+)
isl2a LOC106561155 coding upstream 170260 73163759 ~ 73169203 (+)
tmem266 LOC106561154 coding upstream 193340 73084289 ~ 73146123 (+)
lactb LOC106561153 coding upstream 264194 73072417 ~ 73075269 (+)
LOC110495666 LOC106573503 coding upstream 269865 73056128 ~ 73069598 (+)
si:dkey-24l11.2 LOC106561161 coding downstream 11728 73351800 ~ 73361169 (+)
LOC110495809 LOC106561197 coding downstream 21237 73361309 ~ 73362530 (+)
LOC110495840 LOC106561167 coding downstream 60187 73400259 ~ 73405787 (+)
slc28a1 LOC106561167 coding downstream 68980 73409052 ~ 73418838 (+)
malt3 LOC106561168 coding downstream 96062 73436134 ~ 73454862 (+)
G181989 LOC107750509 non-coding upstream 10602 73327462 ~ 73328861 (+)
G181948 NA non-coding upstream 42780 73269027 ~ 73296683 (+)
G181930 LOC106561156 non-coding upstream 66431 73244895 ~ 73273032 (+)
G181887 NA non-coding upstream 145098 73193347 ~ 73194365 (+)
G181841 NA non-coding upstream 181610 73111501 ~ 73157853 (+)
G181965 NA non-coding downstream 25507 73365579 ~ 73366983 (+)
G182020 NA non-coding downstream 73590 73413662 ~ 73414721 (+)
G182124 NA non-coding downstream 233533 73573605 ~ 73573921 (+)
G182037 NA non-coding downstream 247032 73587104 ~ 73587665 (+)
G182154 LOC108230026 non-coding downstream 295555 73635627 ~ 73636093 (+)
LOC110533853 LOC106561194 other upstream 1085736 72250884 ~ 72253809 (+)
LOC110495604 LOC106573778 other upstream 1274268 72059717 ~ 72065199 (+)
igf1ra igf1r other upstream 2531559 70794530 ~ 70905277 (+)
G177812 NA other upstream 3226023 70107286 ~ 70113440 (+)
G177067 NA other upstream 3882030 69456558 ~ 69457433 (+)
G181995 NA other downstream 1308 73341380 ~ 73342277 (+)
LOC110501876 LOC106561170 other downstream 236693 73456669 ~ 73580075 (+)
G182139 LOC106561173 other downstream 266820 73606892 ~ 73610237 (+)
G182144 NA other downstream 282464 73622536 ~ 73624518 (+)
G183361 NA other downstream 1189577 74529649 ~ 74535026 (+)

Expression


G181994 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G181994 Expression in each Bioproject

Bar chart with 18 bars.
G181994 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network