G184376



Basic Information


Item Value
gene id G184376
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 75121174 ~ 75121414 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU209169
TAAAACAGTAGTATCATGGACATAGTAACTGAAGTTTAAAACAGTAGTATCATGGACATAGTAACTGAAGTTTAAAACAGTATTATCATGGACATAGTAACTGAAGTTTAAAACCGTAGTATCATGGACATAGTAACTGAAGTTTAAAACCGTAGTATCATGGACATAGTAACTGAAGTTTAAAACCGTAGTATCATGGTCATAGTAACTGAAGTTTAAAACAGTAGTATCATGGACATAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU209169 True 241 lncRNA 0.42 1 75121174 75121414

Neighbor


gene id symbol gene type direction distance location
LOC118936821 LOC106561223 coding upstream 132483 74971238 ~ 74988691 (+)
LOC110496126 LOC106561207 coding upstream 158184 74910467 ~ 74962990 (+)
LOC110496116 LOC106561204 coding upstream 230348 74828267 ~ 74890826 (+)
LOC110496107 LOC106561202 coding upstream 388492 74660359 ~ 74732682 (+)
LOC110496089 LOC105018423 coding upstream 591575 74519776 ~ 74529599 (+)
LOC110501950 LOC106561208 coding downstream 20588 75142002 ~ 75256839 (+)
LOC110496163 LOC106561209 coding downstream 157456 75278870 ~ 75305291 (+)
LOC118942025 NA coding downstream 431835 75553249 ~ 75554613 (+)
lep LOC106561227 coding downstream 444065 75565479 ~ 75567166 (+)
LOC110496192 LOC106561214 coding downstream 501831 75623245 ~ 75634823 (+)
G184365 NA non-coding upstream 32028 75088902 ~ 75089146 (+)
G184361 NA non-coding upstream 37397 75083478 ~ 75083777 (+)
G184360 NA non-coding upstream 38524 75082407 ~ 75082650 (+)
G184359 NA non-coding upstream 39145 75081821 ~ 75082029 (+)
G184358 NA non-coding upstream 41011 75079932 ~ 75080163 (+)
G184384 NA non-coding downstream 8120 75129534 ~ 75129742 (+)
G184386 NA non-coding downstream 9731 75131145 ~ 75131378 (+)
G184387 NA non-coding downstream 10502 75131916 ~ 75132123 (+)
LOC110496136 LOC106561223 non-coding downstream 21265 74991655 ~ 75145608 (+)
G184421 NA non-coding downstream 73315 75194729 ~ 75195520 (+)
G183361 NA other upstream 586148 74529649 ~ 74535026 (+)
G182144 NA other upstream 1496656 73622536 ~ 73624518 (+)
LOC110496459 LOC106561246 other downstream 1046243 76167573 ~ 76181555 (+)
G185462 chkb other downstream 1312403 76433817 ~ 76434615 (+)
G185549 LOC106561235 other downstream 1412964 76534378 ~ 76606975 (+)
G185718 NA other downstream 1708999 76830413 ~ 76832500 (+)
LOC110502025 LOC106573403 other downstream 2026239 76863449 ~ 77160850 (+)

Expression


G184376 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G184376 Expression in each Bioproject

Bar chart with 7 bars.
G184376 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network