G186120



Basic Information


Item Value
gene id G186120
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 76102183 ~ 76102549 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU211132
ctatactctctacactcgccagttttagctttagccagcaccatcttcagattagccttaacgtcggtagccctgccccctggtaaacagtgtatgatcgctggatgattcgttttaagtctaatactgtgggtaatggagtcgccaatgactagggttttcaatttgtcagagctaatggtggtaggcttcggcgtctcagacccaataacgggaggagtagagacaagagaaggctcggcctcagactccgactcgcataatggggaaaaccggttgaaagtttctgtcggctgaatgagcgacaccggttgaggattcctacagcatttccctccagaaaccttgagaaagttgtctggctgcg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU211132 True 367 lncRNA 0.49 1 76102183 76102549
Loading

Neighbor


gene id symbol gene type direction distance location
adm2b adm2 coding downstream 2274 76093170 ~ 76099909 (-)
miox miox coding downstream 32350 76066800 ~ 76069833 (-)
tnni1c LOC106561253 coding downstream 113126 75985156 ~ 75989573 (-)
ddx11 ddx11 coding downstream 186880 75901207 ~ 75915303 (-)
LOC110496262 LOC106561255 coding downstream 217002 75846541 ~ 75885181 (-)
ppp6r2b ppp6r2 coding upstream 32814 76135363 ~ 76168156 (-)
LOC110496478 kcp coding upstream 85771 76188320 ~ 76231575 (-)
LOC110496468 LOC106561244 coding upstream 106790 76209339 ~ 76212919 (-)
si:dkey-234i14.6 LOC106561240 coding upstream 219208 76321757 ~ 76341834 (-)
prpf18 prpf18 coding upstream 263122 76365671 ~ 76379828 (-)
G186112 NA non-coding downstream 17644 76083780 ~ 76084539 (-)
G186106 NA non-coding downstream 25459 76076418 ~ 76076724 (-)
G185939 fkbp4 non-coding downstream 166196 75871061 ~ 75935987 (-)
G186006 NA non-coding downstream 214545 75887359 ~ 75887638 (-)
G186001 NA non-coding downstream 225053 75876195 ~ 75877130 (-)
G186121 NA non-coding upstream 181 76102730 ~ 76103045 (-)
G186123 NA non-coding upstream 4229 76106778 ~ 76107013 (-)
G186127 NA non-coding upstream 15946 76118495 ~ 76118927 (-)
G186146 NA non-coding upstream 68749 76171298 ~ 76171526 (-)
G186060 LOC108264052 non-coding upstream 70216 76172765 ~ 76172998 (-)
G186002 NA other downstream 224123 75877359 ~ 75878060 (-)
LOC110496186 LOC106561212 other downstream 495535 75595366 ~ 75607735 (-)
G184006 LOC106561202 other downstream 1369546 74730872 ~ 74732637 (-)
G186197 LOC106561241 other upstream 170975 76273524 ~ 76293392 (-)
LOC110496628 rabl2b other upstream 1067414 77166074 ~ 77171661 (-)
G187490 NA other upstream 1367844 77470393 ~ 77471675 (-)
G187579 LOC106561332 other upstream 1600350 77702899 ~ 77703489 (-)

Expression


G186120 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G186120 Expression in each Bioproject

Bar chart with 20 bars.
G186120 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network