G185352 (ppp6r2)


Basic Information

Item Value
gene id G185352
gene name ppp6r2
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 76150535 ~ 76150879 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU210252
CAAAAGGGCTGAAAGTCAGTGAACTTGGCCCAGCCCTTCTCAGCCTCTGTAGTTACAGGCTGTGGGGCGGGACTTCCCCATGCGTCTACGGCCACTCCGTGCTTGGGGGCAGGGCTGTCCCATGGGTCTACGCCCACTCCAGGCGTGGGGGCGGGGCTACCCCATGGGTCTACACCCACTCCAGGCGTGGGGGCGGGGCTACCCCATGGGTCTACACCCACTCCAGGCTTGGGGGCGGGGCTACCCCATGGGTCCACTCCAGATGAGGGGGAGTTAAAGTTCACCTCCCCGAAACTAGCCGCC

Function

symbol description
ppp6r2 Predicted to enable protein phosphatase regulator activity. Predicted to be involved in regulation of phosphoprotein phosphatase activity. Located in cytosol and intracellular membrane-bounded organelle.

NR:

description
serine/threonine-protein phosphatase 6 regulatory subunit 2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU210252 True 303 lncRNA 0.65 2 76150535 76150879

Neighbor

gene id symbol gene type direction distance location
lmf2a lmf2 coding upstream 83856 76053982 ~ 76066679 (+)
c2cd5 LOC106561251 coding upstream 97392 75993882 ~ 76053143 (+)
LOC110496319 b4galnt3 coding upstream 167929 75939769 ~ 75982606 (+)
LOC110496313 fkbp4 coding upstream 214538 75915637 ~ 75935997 (+)
LOC110496295 LOC106561258 coding upstream 248493 75894189 ~ 75902042 (+)
LOC110496459 LOC106561246 coding downstream 16694 76167573 ~ 76181555 (+)
LOC110496485 LOC106561242 coding downstream 115524 76266403 ~ 76272163 (+)
cd9a LOC106561241 coding downstream 122633 76273512 ~ 76293411 (+)
LOC110496527 sephs1 coding downstream 238650 76389529 ~ 76398538 (+)
LOC100135907 LOC100135907 coding downstream 380540 76531419 ~ 76537667 (+)
G185326 NA non-coding upstream 46111 76104123 ~ 76104424 (+)
G185228 NA non-coding upstream 166134 75984050 ~ 75984401 (+)
G185211 NA non-coding upstream 293678 75856129 ~ 75856857 (+)
G185205 NA non-coding upstream 304960 75843761 ~ 75845575 (+)
G185204 NA non-coding upstream 307134 75842626 ~ 75843401 (+)
G185367 NA non-coding downstream 36696 76187575 ~ 76187870 (+)
G185376 kcp non-coding downstream 52377 76203256 ~ 76204036 (+)
G185424 NA non-coding downstream 149456 76300335 ~ 76300615 (+)
G185431 NA non-coding downstream 158075 76308954 ~ 76310593 (+)
G185450 NA non-coding downstream 193113 76343992 ~ 76344405 (+)
LOC110496136 LOC106561223 other upstream 1063128 74991655 ~ 75145608 (+)
LOC110496116 LOC106561204 other upstream 1264035 74828267 ~ 74890826 (+)
LOC110496107 LOC106561202 other upstream 1436421 74660359 ~ 74732682 (+)
G183361 NA other upstream 1615509 74529649 ~ 74535026 (+)
G182144 NA other upstream 2526017 73622536 ~ 73624518 (+)
G185462 chkb other downstream 282938 76433817 ~ 76434615 (+)
G185549 LOC106561235 other downstream 383499 76534378 ~ 76606975 (+)
G185718 NA other downstream 679534 76830413 ~ 76832500 (+)
LOC110502025 LOC106573403 other downstream 996774 76863449 ~ 77160850 (+)

Expression


Co-expression Network