G190085



Basic Information


Item Value
gene id G190085
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 80075094 ~ 80075378 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU215440
cttctggctgtgccgggtggagattataacagaacatggccaagatgttcaaatgttcataaatgaccagcatggtcaaataataataatcacaggcagaacagttgaaactagagcagcagcacggccaggtggactggggacagcaaggagtcatcatgtcaggtagtcctgaggcatggtcctagggctcaggtcctcagcgagagagaaagaaagagagaaagagagaattagagagagcatacttaaattcacacaggacaccggataggacaggagaag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU215440 True 285 lncRNA 0.47 1 80075094 80075378

Neighbor


gene id symbol gene type direction distance location
LOC110497165 lrrc4c coding upstream 26912 79916922 ~ 80048182 (+)
LOC110497158 LOC106573351 coding upstream 839185 79177028 ~ 79235909 (+)
LOC110497132 pamr1 coding upstream 923735 79103574 ~ 79151359 (+)
LOC118944149 NA coding upstream 1143618 78931423 ~ 78931476 (+)
LOC110497055 LOC106561315 coding upstream 1494904 78578149 ~ 78580190 (+)
rag2 rag2 coding downstream 648982 80724360 ~ 80727535 (+)
furinb LOC106561302 coding downstream 704681 80780059 ~ 80977313 (+)
LOC110497237 rccd1 coding downstream 915600 80988887 ~ 80994869 (+)
LOC110502143 LOC106573336 coding downstream 953963 81029341 ~ 81031876 (+)
LOC118942351 NA coding downstream 956621 81031999 ~ 81033476 (+)
G190074 NA non-coding upstream 12010 80062168 ~ 80063084 (+)
G190063 NA non-coding upstream 34650 80040211 ~ 80040444 (+)
G190062 NA non-coding upstream 35211 80039683 ~ 80039883 (+)
G190024 NA non-coding upstream 114347 79954152 ~ 79960747 (+)
G190022 NA non-coding upstream 125918 79948886 ~ 79949176 (+)
G190090 NA non-coding downstream 3997 80079375 ~ 80079592 (+)
G190182 NA non-coding downstream 12115 80087493 ~ 80087855 (+)
G190193 NA non-coding downstream 17734 80093112 ~ 80093321 (+)
G190202 NA non-coding downstream 22658 80098036 ~ 80098587 (+)
G190320 NA non-coding downstream 111110 80186488 ~ 80186930 (+)
LOC110496993 LOC106561317 other upstream 1568162 78467699 ~ 78519071 (+)
G187320 LOC106561323 other upstream 1805049 78267289 ~ 78270045 (+)
G187260 NA other upstream 1897511 78137513 ~ 78177583 (+)
LOC110502077 LOC106561326 other upstream 2026294 78047373 ~ 78066844 (+)
G191052 NA other downstream 679763 80755141 ~ 80756647 (+)
G191057 accs other downstream 689954 80765332 ~ 80766714 (+)
LOC110497314 cfap44 other downstream 990176 81058184 ~ 81080502 (+)
LOC110497320 paf other downstream 1008450 81083756 ~ 81086188 (+)
LOC110497665 LOC106561427 other downstream 2290907 82366183 ~ 82393779 (+)

Expression


G190085 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G190085 Expression in each Bioproject

Bar chart with 15 bars.
G190085 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network