G196816



Basic Information


Item Value
gene id G196816
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 85501891 ~ 85502224 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU222791
ggatagatatagatctgtagcagtttgggtctagaggcagggtaggatagatataggtctgtagcagtttggttctagaggcagggtaggatagatataggtctgtagcagtttggttctagaggcagggtaggatagatataggtctgtagcagtttggttctagaggcagggtaggatagatataggtctgtagcagttt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU222791 True 202 lncRNA 0.35 3 85501891 85502224

Neighbor


gene id symbol gene type direction distance location
LOC110498095 fam180a coding upstream 31209 85465054 ~ 85470682 (+)
LOC110498083 LOC106561381 coding upstream 134329 85206278 ~ 85367562 (+)
LOC118937296 NA coding upstream 303789 85196609 ~ 85198102 (+)
LOC110498064 NA coding upstream 307063 85192014 ~ 85194828 (+)
LOC110498034 LOC106573178 coding upstream 447499 85010068 ~ 85054392 (+)
LOC110498104 LOC106561378 coding downstream 13395 85515619 ~ 85594581 (+)
LOC110498123 LOC106561377 coding downstream 198546 85700770 ~ 85711408 (+)
agk LOC106561375 coding downstream 225760 85727984 ~ 85734628 (+)
wee2 LOC106561372 coding downstream 246537 85748761 ~ 85754211 (+)
bida LOC106561376 coding downstream 253401 85755625 ~ 85765031 (+)
G196791 NA non-coding upstream 40363 85460837 ~ 85461528 (+)
G196788 NA non-coding upstream 43757 85457908 ~ 85458134 (+)
G196783 NA non-coding upstream 49770 85451916 ~ 85452121 (+)
G196781 NA non-coding upstream 52441 85449126 ~ 85449450 (+)
G196522 NA non-coding upstream 108836 85388082 ~ 85393055 (+)
G196877 NA non-coding downstream 100349 85602573 ~ 85603490 (+)
G196905 NA non-coding downstream 273264 85775488 ~ 85777938 (+)
G196990 NA non-coding downstream 339793 85842017 ~ 85843259 (+)
G197031 LOC106561367 non-coding downstream 448195 85950419 ~ 85950944 (+)
G197036 NA non-coding downstream 455942 85958166 ~ 85961475 (+)
G195155 NA other upstream 901567 84596410 ~ 84600324 (+)
G194395 NA other upstream 1942293 83558920 ~ 83559598 (+)
LOC110497837 tmem263 other upstream 2376926 83119221 ~ 83124965 (+)
G193339 LOC106561425 other upstream 2847461 82652633 ~ 82654430 (+)
G197069 NA other downstream 633392 86135616 ~ 86136608 (+)
G198417 LOC106561459 other downstream 1535287 87037511 ~ 87039236 (+)
G198575 NA other downstream 1647978 87150202 ~ 87150490 (+)
G198784 NA other downstream 1991399 87493623 ~ 87496735 (+)
G198811 LOC106561481 other downstream 2033712 87535936 ~ 87536928 (+)

Expression


G196816 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G196816 Expression in each Bioproject

Bar chart with 17 bars.
G196816 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network