G201515



Basic Information


Item Value
gene id G201515
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 89463194 ~ 89468148 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU228099
atgtactgtcatgttgtgtcttgtttctgtcctttcctttcaccctgtctccctctgctggtcgtactaggttaccgtttctgtccctctttcccccagctgttccttgtcttctctgactacctcattcaccccctttcccacctgttccctttttccctctgattaggtccctatatctctctctgtttctgctcctgtctttgtcggattcttgtttgtgtgtctcatgcctgaaccagactatcatcgtgtttgctgcaaccttgtcctgtcctgtcggaatctacctgtccatctgagccca
>TU228100
atgtactgtcatgttgtgtcttgtttctgtcctttcctttcaccctgtctccctctgctggtcgtactaggttaccgtttctgtccctctttcccccagctgttccttgtcttctctgactacctcattcaccccctttcccacctgttccctttttccctctgattaggtccctatatctctctctgtttctgctcctgtctttgtcggattcttgtttgtgtgtctcatgcctgaaccagactatcatcgtgtttgctgcaaccttgtcctgtcctgtcggaatctacctgtccatctgagccca

Function


GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU228099 False 307 lncRNA 0.49 2 89463194 89468148
TU228100 True 307 lncRNA 0.49 2 89463194 89468148

Neighbor


gene id symbol gene type direction distance location
LOC110502285 sall1 coding downstream 19550 89437266 ~ 89443782 (-)
LOC110499228 LOC106561526 coding downstream 254609 89205876 ~ 89208585 (-)
LOC110499212 faap24 coding downstream 336015 89124306 ~ 89127179 (-)
slc7a10b LOC106561521 coding downstream 339029 89106985 ~ 89124165 (-)
dus2 dus2 coding downstream 356467 89100257 ~ 89106727 (-)
LOC110499252 papd5 coding upstream 8862 89477010 ~ 89493170 (-)
hsd17b2 hsd17b2 coding upstream 33927 89502075 ~ 89505985 (-)
gpia LOC100196524 coding upstream 38476 89506624 ~ 89528804 (-)
lsm14aa LOC106561533 coding upstream 70350 89538498 ~ 89555355 (-)
LOC110499327 LOC106561534 coding upstream 109646 89577794 ~ 89587145 (-)
G201506 NA non-coding downstream 11543 89451242 ~ 89451651 (-)
G201489 NA non-coding downstream 31903 89431061 ~ 89431291 (-)
G201485 NA non-coding downstream 40822 89420497 ~ 89422372 (-)
G201476 rbl2 non-coding downstream 56989 89405591 ~ 89406205 (-)
G201540 LOC106561532 non-coding upstream 90151 89558299 ~ 89559038 (-)
G201544 NA non-coding upstream 105806 89573954 ~ 89577425 (-)
G201561 NA non-coding upstream 126444 89594592 ~ 89595015 (-)
G201627 NA non-coding upstream 207883 89676031 ~ 89677465 (-)
G201667 LOC106561542 non-coding upstream 307351 89775499 ~ 89777092 (-)
G198912 NA other downstream 2136725 87322139 ~ 87326469 (-)
G198342 LOC100194703 other downstream 2559238 86903036 ~ 86903956 (-)
G197554 NA other downstream 3499529 85959845 ~ 85963665 (-)
G197498 slc25a18 other downstream 3619701 85831239 ~ 85843493 (-)
LOC110498022 LOC106561385 other downstream 4823438 84596433 ~ 84910878 (-)
LOC110499346 vps4a other upstream 138689 89606837 ~ 89609890 (-)
G202279 NA other upstream 909409 90377557 ~ 90441425 (-)
G203915 rassf9 other upstream 2121064 91589212 ~ 91591049 (-)
G204024 NA other upstream 2319039 91787187 ~ 91788103 (-)
LOC110499897 LOC106573100 other upstream 2929912 92398054 ~ 92443838 (-)

Expression


G201515 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G201515 Expression in each Bioproject

Bar chart with 13 bars.
G201515 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network