G201561



Basic Information


Item Value
gene id G201561
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 89594592 ~ 89595015 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU228150
ttctgaagctatataaaagccagtgttctgttcaggagagaggttgattttgctgggagttcattgctgggaagtggtatgttctgtgagtttgttgctcaggtagagcttagttgatgtcctttgtttcttagtttgtttgtaaaattgtttaatattctgtttcatttgttcccaggggggaaggggaaggcaccttgggagtgtttaggcaagaggcccgcgggcatacatatacccgtagtatattcactgtctaggcacactaggtaagacctgggcggaccaccccctgtattttggttagggcaccaggtggtgctaaattaggtaaaagtggttaggcaggtaagataggagagaggg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU228150 True 366 lncRNA 0.41 2 89594592 89595015

Neighbor


gene id symbol gene type direction distance location
LOC110499327 LOC106561534 coding downstream 7447 89577794 ~ 89587145 (-)
lsm14aa LOC106561533 coding downstream 39237 89538498 ~ 89555355 (-)
gpia LOC100196524 coding downstream 65788 89506624 ~ 89528804 (-)
hsd17b2 hsd17b2 coding downstream 88607 89502075 ~ 89505985 (-)
LOC110499252 papd5 coding downstream 101422 89477010 ~ 89493170 (-)
LOC110499346 vps4a coding upstream 12239 89606837 ~ 89609890 (-)
LOC110499336 LOC106561536 coding upstream 15222 89610237 ~ 89709230 (-)
LOC118944147 NA coding upstream 52447 89647462 ~ 89647514 (-)
tph2 tph2 coding upstream 145174 89740189 ~ 89748145 (-)
LOC110499378 LOC106561541 coding upstream 156728 89751743 ~ 89763372 (-)
G201544 NA non-coding downstream 17167 89573954 ~ 89577425 (-)
G201540 LOC106561532 non-coding downstream 35554 89558299 ~ 89559038 (-)
G201515 NA non-coding downstream 126444 89463194 ~ 89468148 (-)
G201506 NA non-coding downstream 142941 89451242 ~ 89451651 (-)
LOC110502285 sall1 non-coding downstream 150810 89437266 ~ 89443782 (-)
G201627 NA non-coding upstream 81016 89676031 ~ 89677465 (-)
G201667 LOC106561542 non-coding upstream 180484 89775499 ~ 89777092 (-)
G201664 LOC106561542 non-coding upstream 184087 89779102 ~ 89780286 (-)
G201673 LOC106561542 non-coding upstream 186779 89781794 ~ 89785665 (-)
G201671 LOC106561542 non-coding upstream 193871 89788886 ~ 89789501 (-)
G198912 NA other downstream 2268123 87322139 ~ 87326469 (-)
G198342 LOC100194703 other downstream 2690636 86903036 ~ 86903956 (-)
G197554 NA other downstream 3630927 85959845 ~ 85963665 (-)
G197498 slc25a18 other downstream 3751099 85831239 ~ 85843493 (-)
LOC110498022 LOC106561385 other downstream 4954836 84596433 ~ 84910878 (-)
G202279 NA other upstream 782542 90377557 ~ 90441425 (-)
G203915 rassf9 other upstream 1994197 91589212 ~ 91591049 (-)
G204024 NA other upstream 2192172 91787187 ~ 91788103 (-)
LOC110499897 LOC106573100 other upstream 2803045 92398054 ~ 92443838 (-)

Expression


G201561 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G201561 Expression in each Bioproject

Bar chart with 20 bars.
G201561 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network