G202185



Basic Information


Item Value
gene id G202185
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 90716942 ~ 90717421 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU228879
gaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcggagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaatatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcctatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU228879 True 480 TUCP 0.47 1 90716942 90717421

Neighbor


gene id symbol gene type direction distance location
dusp6 dus6 coding upstream 10917 90701413 ~ 90706025 (+)
poc1b poc1b coding upstream 49530 90607090 ~ 90667412 (+)
LOC110499537 LOC106561558 coding upstream 117648 90594450 ~ 90599294 (+)
cpa5 cbpa1 coding upstream 122604 90577920 ~ 90594338 (+)
wnt2 LOC106561551 coding upstream 520006 90183281 ~ 90196936 (+)
si:dkey-106n21.1 LOC106561561 coding downstream 75827 90793248 ~ 90868325 (+)
kitlga LOC106561562 coding downstream 220925 90938346 ~ 90971318 (+)
cep290 cep290 coding downstream 440040 91157461 ~ 91213269 (+)
LOC110499641 LOC106561583 coding downstream 518044 91235465 ~ 91239737 (+)
mgat4c LOC106561589 coding downstream 648861 91366282 ~ 91543765 (+)
G202180 NA non-coding upstream 8111 90708576 ~ 90708831 (+)
G202057 NA non-coding upstream 233734 90482966 ~ 90483208 (+)
G202055 NA non-coding upstream 238295 90478428 ~ 90478647 (+)
G202052 NA non-coding upstream 244636 90472080 ~ 90472306 (+)
G202041 NA non-coding upstream 266705 90450032 ~ 90450237 (+)
G202514 NA non-coding downstream 18104 90735525 ~ 90735817 (+)
G202534 NA non-coding downstream 50439 90767860 ~ 90768063 (+)
G202555 NA non-coding downstream 69617 90787038 ~ 90787317 (+)
G202558 NA non-coding downstream 72031 90789452 ~ 90789667 (+)
G202656 yo84 non-coding downstream 238989 90956410 ~ 91052753 (+)
G202039 NA other upstream 269369 90447118 ~ 90447573 (+)
LOC110499234 rbl2 other upstream 1294504 89395057 ~ 89422438 (+)
G199223 hipk3 other upstream 2848975 87866877 ~ 87867967 (+)
G198811 LOC106561481 other upstream 3180014 87535936 ~ 87536928 (+)
G198784 NA other upstream 3220207 87493623 ~ 87496735 (+)
G203414 NA other downstream 904580 91622001 ~ 91624293 (+)
G203438 LOC106561592 other downstream 951415 91668836 ~ 91671899 (+)
G203551 NA other downstream 1109428 91826849 ~ 91847400 (+)

Expression


G202185 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G202185 Expression in each Bioproject

Bar chart with 21 bars.
G202185 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network