G207749



Basic Information


Item Value
gene id G207749
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 95662647 ~ 95663871 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU235161
gtctactacacctgttgtattcagcatttcactgtagggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctattgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtagggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctattgtattcagcatttcactgtaaggtctacctacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctacctacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtgaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattctgcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtctactacacctgttgtattcagcatttcactgtaaggtcctacacctgttgtattcagcatttcactgtaaggtctactacacct

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU235161 True 1037 lncRNA 0.40 2 95662647 95663871
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502472 LOC105029723 coding upstream 56822 95482323 ~ 95605825 (+)
LOC110502465 LOC106561692 coding upstream 245783 95372098 ~ 95416864 (+)
LOC110502458 LOC106561691 coding upstream 302773 95296621 ~ 95359874 (+)
LOC110500415 LOC106561689 coding upstream 401613 95221223 ~ 95261034 (+)
LOC118944165 NA coding upstream 459079 95203437 ~ 95203568 (+)
grp94 LOC106561706 coding downstream 15055 95678926 ~ 95686855 (+)
LOC110502494 cdhr3 coding downstream 24690 95688561 ~ 95698740 (+)
LOC110500475 prkar2b coding downstream 67986 95731857 ~ 95747216 (+)
LOC110500485 hbp1 coding downstream 87008 95750879 ~ 95763143 (+)
LOC118936882 NA coding downstream 221716 95885587 ~ 95888114 (+)
G207786 NA non-coding upstream 344 95661016 ~ 95662303 (+)
G207696 NA non-coding upstream 29248 95632209 ~ 95633399 (+)
G207770 NA non-coding upstream 37641 95624201 ~ 95625006 (+)
G207766 NA non-coding upstream 45523 95616882 ~ 95617124 (+)
G207765 NA non-coding upstream 45819 95616440 ~ 95616828 (+)
G207797 NA non-coding downstream 35411 95699282 ~ 95703736 (+)
G207798 NA non-coding downstream 42583 95706454 ~ 95720856 (+)
G207806 NA non-coding downstream 59754 95723625 ~ 95723889 (+)
G207818 NA non-coding downstream 100421 95764292 ~ 95764518 (+)
G207821 NA non-coding downstream 105428 95769299 ~ 95769552 (+)
G206926 NA other upstream 956399 94705946 ~ 94706248 (+)
G206908 NA other upstream 1030380 94631829 ~ 94632267 (+)
G206850 NA other upstream 1100423 94557169 ~ 94562224 (+)
LOC110500139 LOC106561672 other upstream 1224965 94391364 ~ 94437682 (+)
G206389 LOC106561642 other upstream 1560775 94100979 ~ 94101872 (+)
G208404 NA other downstream 563922 96227793 ~ 96228463 (+)
G208836 NA other downstream 948558 96612429 ~ 96613459 (+)
G209586 NA other downstream 1822605 97486476 ~ 97486772 (+)
G209591 NA other downstream 1954746 97618617 ~ 97619089 (+)
LOC110500822 LOC106561728 other downstream 2034240 97695939 ~ 97711108 (+)

Expression


G207749 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G207749 Expression in each Bioproject

Bar chart with 19 bars.
G207749 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network