G208170



Basic Information


Item Value
gene id G208170
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 95871820 ~ 95899031 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU235679
gagcctttccgttcaccttcacactcctgggccagactacactcaatcatatgacccactgaagagatgagtcttcagtaaagacttaaaagttgagaccgagtttgcgtctctgacatgggtaggcagaccgttccataaaaatggagctctgtaggagaaagccctgcctccagctgtttgcttagaaattctagggacaattaggaggcctgcgtcttgtgaccgtagcgtacgtgtaggtatatacggcaggaccaaatcagagagataggagcaagcccatgtaatgctttgtaggttagcagtaaaaccttgaaatcagcccttgctttgacaggaagccagtgtagggaggctagcactggagtaatatgatcaaattttttggttctagtcaggattctagcagccgtatttagcactaactgaagtttatttagtgctttatccgggtagccggaaagtaaagcattgcagtagtctaacctagaagtgacaaaagcatggattaatttttctgcatcatttttggacagaaactttctgatttttgcaatgttacgtagatggaaaaaagctgtccttgaaatggtcttgatatgttcttcaaaagagagatcagggtccagagta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU235679 True 636 lncRNA 0.46 2 95871820 95899031
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110500466 nampt coding downstream 150705 95703359 ~ 95721115 (-)
LOC110502485 LOC106561707 coding downstream 207317 95635896 ~ 95664503 (-)
parietopsin LOC106561711 coding downstream 239848 95628449 ~ 95632062 (-)
LOC118944198 NA coding downstream 600548 95271093 ~ 95271272 (-)
LOC110502417 LOC106561684 coding downstream 747273 95097379 ~ 95124547 (-)
LOC110502500 LOC106561698 coding upstream 152271 96051302 ~ 96092405 (-)
LOC110502509 LOC106561697 coding upstream 231280 96129727 ~ 96370206 (-)
LOC110500576 NA coding upstream 734810 96633841 ~ 96640404 (-)
LOC110500541 LOC106561741 coding upstream 748099 96647130 ~ 96897073 (-)
pik3c2g LOC106561742 coding upstream 1120560 97019591 ~ 97077900 (-)
G208168 NA non-coding downstream 1605 95869578 ~ 95870215 (-)
G208107 NA non-coding downstream 19533 95852078 ~ 95852287 (-)
G208094 NA non-coding downstream 25736 95845659 ~ 95846084 (-)
G208065 NA non-coding downstream 102659 95768856 ~ 95769161 (-)
G208060 NA non-coding downstream 107770 95763794 ~ 95764050 (-)
G208215 NA non-coding upstream 61798 95960829 ~ 95961041 (-)
G208226 NA non-coding upstream 73802 95972833 ~ 95973147 (-)
G208306 NA non-coding upstream 101885 96000916 ~ 96002828 (-)
G208316 NA non-coding upstream 111995 96011026 ~ 96013459 (-)
G208319 NA non-coding upstream 125895 96024926 ~ 96026020 (-)
G208077 NA other downstream 39458 95829374 ~ 95832362 (-)
G207876 LOC106561706 other downstream 184956 95680851 ~ 95686864 (-)
G207884 NA other downstream 262034 95604228 ~ 95609786 (-)
G207959 NA other downstream 347593 95523968 ~ 95524227 (-)
G207858 LOC106561692 other downstream 463106 95377723 ~ 95408714 (-)
G208472 NA other upstream 235046 96134077 ~ 96134472 (-)
G208658 NA other upstream 522835 96421866 ~ 96422224 (-)
G209560 NA other upstream 1517790 97416821 ~ 97417188 (-)
G209802 NA other upstream 1602141 97501172 ~ 97502394 (-)
G209841 NA other upstream 1719828 97618859 ~ 97619212 (-)

Expression


G208170 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G208170 Expression in each Bioproject

Bar chart with 20 bars.
G208170 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network