XLOC_021482 (ccm2l)


Basic Information

Item Value
gene id XLOC_021482
gene name ccm2l
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 9035578 ~ 9054948 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00042693
AGCCAGCCATCGGGCTGGTCAAAATGGACTATGATCCCAAGCGAACCAAGAAGGGATTCGTGTCTCCAATAAAGCGCCTAGTGTTCCCTAAATCTAGCCGGCGACAGGTGGACAAAGGCAGTGTTTACCGCAGACCCCTTCACACCGTCCCGCTTTACCCACCTGACTACCTCATCCACCCAGAGAGACTCATCTATGACTATGTGGAGAAGGAGGTCAAGTTCCTGGGACACCTGACATGGGTGTCCTGTTCCCTGAACCCATCCAGCAGAGACGAGCTGCTGCAGCTTCTGGACACAGCCAGGAAGCTGAGGGTTTTACCTCTGAAGACCAGTGTTGAACAGGACTGTATTCTCAGTCTGTCTGCTCGCTGTCTGCTGCTTACCTGGAGAGACAATGAAAAACTGCTGCTGAGGATCCCTACACATGAAATTGCTGCTGCCTCCTACCTGCGGGATGATGC

Function

symbol description
ccm2l Acts upstream of or within anterior/posterior axis specification; heart contraction; and heart morphogenesis. Is expressed in heart and notochord. Orthologous to human CCM2L (CCM2 like scaffold protein).

GO:

id name namespace
GO:0007507 heart development biological_process
GO:0009948 anterior/posterior axis specification biological_process
GO:0003007 heart morphogenesis biological_process
GO:0060047 heart contraction biological_process

KEGG: NA

ZFIN:

id description
ZDB-GENE-090313-248 Acts upstream of or within anterior/posterior axis specification; heart contraction; and heart morphogenesis. Is expressed in heart and notochord. Orthologous to human CCM2L (CCM2 like scaffold protein).

Ensembl:

ensembl_id ENSDARG00000063089

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00042693 True 463 mRNA 0.53 4 9035578 9054948

Neighbor

gene id symbol gene type direction distance location
XLOC_021481 xkr7 coding upstream 20552 8989168 ~ 9015026 (+)
XLOC_021479 NA coding upstream 223924 8787995 ~ 8811654 (+)
XLOC_021480 sox18 coding upstream 235698 8797143 ~ 8799880 (+)
XLOC_021478 rgs19 coding upstream 335585 8679216 ~ 8699993 (+)
XLOC_021477 kif3b coding upstream 1298859 7710447 ~ 7736719 (+)
XLOC_021483 ccm2l coding downstream 3051 9057999 ~ 9084866 (+)
XLOC_021484 cables2b coding downstream 33243 9088191 ~ 9137648 (+)
XLOC_021485 si:dkey-66g10.2 coding downstream 151402 9206350 ~ 9211297 (+)
XLOC_021486 rps21 coding downstream 165488 9220436 ~ 9228578 (+)
XLOC_021487 acss2 coding downstream 175483 9230431 ~ 9291892 (+)
XLOC_021472 NA non-coding upstream 1600262 7402807 ~ 7435316 (+)
XLOC_021470 si:dkeyp-73a2.2 non-coding upstream 1679798 7350170 ~ 7355780 (+)
XLOC_021469 NA non-coding upstream 1829383 7204539 ~ 7206195 (+)
XLOC_021467 NA non-coding upstream 2169622 6851931 ~ 6865956 (+)
XLOC_021488 CU137717.1 non-coding downstream 252626 9307574 ~ 9308561 (+)
XLOC_021490 NA non-coding downstream 341720 9396668 ~ 9403617 (+)
XLOC_021493 CR388392.1 non-coding downstream 563265 9618213 ~ 9618335 (+)
XLOC_021494 CU466281.1 non-coding downstream 672462 9727410 ~ 9727432 (+)
XLOC_021495 NA non-coding downstream 810753 9865701 ~ 9865938 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G117762 NA unknown CI01000021 null 4045284 ~ 4045446 (-)
mexican tetra (Astyanax mexicanus) G99255 NA non-coding NC_035907.1 CM008310.1 11404781 ~ 11405210 (+)