G210233



Basic Information


Item Value
gene id G210233
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 98352742 ~ 98353076 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU238191
actgcattcattttcagtgaatttaacatgtgtaaatatttgtatgaacataacaagattcaacaactgagacataaactgaacaagttccacagacatgtgactaacagaaatggaataatgtgtccctgaacaaacgggggtcaaaatcaaaagtaacagtcagtatctggtgtggccaccagctgcattaagtactgcagtgcatctcctcctcatggactgcaccagatttgccagtttttactgtgagatgttaccccactcttccaccaaggcacctgcaagtacccagacatttctgggaggaatggccctagacctcaccctccgat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU238191 True 335 lncRNA 0.43 1 98352742 98353076

Neighbor


gene id symbol gene type direction distance location
LOC118943874 tspan18 coding upstream 83299 98161662 ~ 98269443 (+)
LOC118936883 NA coding upstream 260230 98091289 ~ 98092512 (+)
LOC118943872 cd82 coding upstream 266595 98026335 ~ 98086147 (+)
LOC118943873 NA coding upstream 334861 98015424 ~ 98017881 (+)
LOC110500615 LOC106561729 coding upstream 337590 97904868 ~ 98015152 (+)
gp137 gp137 coding downstream 84809 98437885 ~ 98453966 (+)
LOC110500731 LOC106561719 coding downstream 187336 98540412 ~ 98572764 (+)
LOC110500756 pk coding downstream 260674 98613750 ~ 98633108 (+)
LOC118936885 NA coding downstream 445656 98798732 ~ 98799869 (+)
LOC110500657 parp16 coding downstream 501609 98854685 ~ 98868361 (+)
G210198 NA non-coding upstream 47351 98304400 ~ 98305391 (+)
G210190 NA non-coding upstream 54283 98298116 ~ 98298459 (+)
G210095 NA non-coding upstream 150506 98201845 ~ 98202236 (+)
G210082 NA non-coding upstream 171731 98180490 ~ 98181011 (+)
G210060 NA non-coding upstream 213209 98139298 ~ 98139533 (+)
G210238 NA non-coding downstream 4761 98357837 ~ 98358105 (+)
G210242 NA non-coding downstream 12381 98365457 ~ 98365659 (+)
G210245 NA non-coding downstream 14524 98367600 ~ 98368740 (+)
G210268 rbtn2 non-coding downstream 71069 98424145 ~ 98426646 (+)
G210318 NA non-coding downstream 98687 98451763 ~ 98452038 (+)
G209759 NA other upstream 394906 97957244 ~ 97958896 (+)
G209636 NA other upstream 579977 97740061 ~ 97772765 (+)
LOC110500822 LOC106561728 other upstream 652966 97695939 ~ 97711108 (+)
G209591 NA other upstream 733653 97618617 ~ 97619089 (+)
G209586 NA other upstream 865970 97486476 ~ 97486772 (+)
G210408 NA other downstream 344092 98697168 ~ 98700392 (+)
LOC110510476 LOC106561728 other downstream 544448 98897524 ~ 98944948 (+)
G210484 NA other downstream 549712 98902788 ~ 98926406 (+)
G210823 LOC106561768 other downstream 884302 99237378 ~ 99238258 (+)
G210983 LOC106561766 other downstream 1367103 99720179 ~ 99721983 (+)

Expression


G210233 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G210233 Expression in each Bioproject

Bar chart with 21 bars.
G210233 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network