G210632



Basic Information


Item Value
gene id G210632
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 98653561 ~ 98654490 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU238705
actcaatacaggtaccctgcacattgactcagtactggtaccctgcacattgactcaatgcaggtaccctgcacattgactcaatacaggtaccctgcacattgactcaatacaggtaccctgcacattgactcagtactggtaccctgcacattgactcagtactggtaccctgcacattgactcagtactggtaccct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU238705 True 200 lncRNA 0.38 2 98653561 98654490
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110500748 LOC106561725 coding downstream 52311 98587916 ~ 98601250 (-)
edc3 LOC106561715 coding downstream 117871 98521998 ~ 98535690 (-)
LOC110500720 LOC106561717 coding downstream 139700 98474734 ~ 98513861 (-)
lmo2 rbtn2 coding downstream 226903 98424015 ~ 98426658 (-)
LOC110500713 LOC106561713 coding downstream 301076 98313023 ~ 98352485 (-)
LOC110500839 LOC105018309 coding upstream 38266 98692756 ~ 98723102 (-)
LOC110500636 NA coding upstream 141359 98795849 ~ 98808194 (-)
LOC110500630 NA coding upstream 148515 98803005 ~ 98808340 (-)
LOC110502520 LOC105018371 coding upstream 165291 98819781 ~ 98832865 (-)
LOC110500681 scamp5 coding upstream 187947 98842437 ~ 98854773 (-)
G210623 NA non-coding downstream 11846 98639694 ~ 98641715 (-)
G210628 NA non-coding downstream 15015 98638209 ~ 98638546 (-)
G210608 NA non-coding downstream 63185 98590028 ~ 98590376 (-)
G210607 NA non-coding downstream 63657 98589659 ~ 98589904 (-)
G210638 NA non-coding upstream 18896 98673386 ~ 98678696 (-)
G210683 NA non-coding upstream 56656 98711146 ~ 98712557 (-)
G210695 NA non-coding upstream 87988 98742478 ~ 98749276 (-)
G210694 NA non-coding upstream 90577 98745067 ~ 98754802 (-)
G210693 NA non-coding upstream 110914 98765404 ~ 98767695 (-)
LOC118936884 NA other downstream 508044 98127948 ~ 98145517 (-)
G209841 NA other downstream 1034349 97618859 ~ 97619212 (-)
G209802 NA other downstream 1151167 97501172 ~ 97502394 (-)
G209560 NA other downstream 1236373 97416821 ~ 97417188 (-)
G208658 NA other downstream 2231337 96421866 ~ 96422224 (-)
LOC118943885 LOC106561728 other upstream 263958 98914015 ~ 98946069 (-)
LOC118943882 LOC106561728 other upstream 287984 98936783 ~ 98944041 (-)
G210765 NA other upstream 371242 99025732 ~ 99026118 (-)
G211127 NA other upstream 468743 99123233 ~ 99123658 (-)
LOC118936886 NA other upstream 961186 99615676 ~ 99619142 (-)

Expression


G210632 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G210632 Expression in each Bioproject

Bar chart with 4 bars.
G210632 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 35.
End of interactive chart.

Co-expression Network