G212654


Basic Information

Item Value
gene id G212654
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 101477538 ~ 101477750 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU241416
ATCTGGTTGCTTGACACATAACAGTTAATAAGTAGCTATGACCTGACTTGGACCTTGGTAAAGGCCCAACACAATCGATAATAAGATGCTCAAAAGGTTGCCCTACGGCTGGTATTGGATACAAAGGTGCTGGCTTTACAACCTGGTTTGGCTTGCTTGTGCGCTGACACGTATCACAAGTTTTAATAAACTGAGCTACATCCCGCTTTAAAC

Function

NR:

description
uncharacterized protein LOC110514228

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU241416 True 213 lncRNA 0.43 1 101477538 101477750
Loading

Neighbor

gene id symbol gene type direction distance location
best1 LOC102229874 coding upstream 106364 101345285 ~ 101371174 (+)
LOC110501031 LOC106592222 coding upstream 512752 100929368 ~ 100964786 (+)
LOC118936893 NA coding upstream 618276 100848174 ~ 100860603 (+)
LOC110502612 LOC106584763 coding upstream 629197 100785531 ~ 100848341 (+)
sigirr sigirr coding upstream 821932 100638574 ~ 100655606 (+)
LOC110516669 LOC106590745 coding downstream 156880 101634630 ~ 101695484 (+)
LOC110502669 LOC107698134 coding downstream 560288 102038038 ~ 102167821 (+)
LOC110501421 LOC106561865 coding downstream 706609 102184359 ~ 102238260 (+)
LOC110501429 LOC106561864 coding downstream 784367 102262117 ~ 102278883 (+)
LOC110501451 LOC106561861 coding downstream 829747 102307497 ~ 102314434 (+)
G212652 NA non-coding upstream 2578 101474756 ~ 101474960 (+)
G212650 NA non-coding upstream 4360 101472934 ~ 101473178 (+)
G212646 NA non-coding upstream 8573 101468718 ~ 101468965 (+)
G212645 NA non-coding upstream 9298 101467814 ~ 101468240 (+)
G212642 NA non-coding upstream 10989 101464858 ~ 101466549 (+)
G212656 NA non-coding downstream 4431 101482181 ~ 101486796 (+)
G212659 NA non-coding downstream 14012 101491762 ~ 101493034 (+)
G212660 NA non-coding downstream 14137 101491887 ~ 101492631 (+)
G212668 NA non-coding downstream 66408 101544158 ~ 101579963 (+)
G212690 NA non-coding downstream 76674 101554385 ~ 101561158 (+)
G211809 LOC107574289 other upstream 1009381 100467678 ~ 100468157 (+)
G211779 NA other upstream 1015557 100459657 ~ 100461981 (+)
LOC110500919 LOC106584740 other upstream 1577661 99896619 ~ 99899881 (+)
LOC110502581 LOC106561777 other upstream 1663163 99777695 ~ 99818794 (+)
G210983 LOC106561766 other upstream 1755555 99720179 ~ 99721983 (+)
G212674 NA other downstream 32010 101509760 ~ 101516104 (+)
G212863 NA other downstream 265149 101742899 ~ 101745974 (+)
G213051 NA other downstream 699659 102177409 ~ 102177918 (+)

Expression

G212654 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G212654 Expression in each Bioproject

Bar chart with 17 bars.
G212654 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network