G213643


Basic Information

Item Value
gene id G213643
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 102678231 ~ 102678462 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU242666
tagatgggacctggctacatagggtcagaaggatagtagatggacctggctacatagggtcaggaggatagtagatggacctggctacatagggtcagaaggatagtagatgggacctggctacatagggtcagaaggatagtagatgggacctggctacatagggtcagaaggatagtagatgggacctggctacatagggtcagaaggatagtagatgggacctggctac

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU242666 True 232 lncRNA 0.49 1 102678231 102678462
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118936918 NA coding upstream 69898 102600618 ~ 102608333 (+)
LOC110501451 LOC106561861 coding upstream 363797 102307497 ~ 102314434 (+)
LOC110501429 LOC106561864 coding upstream 399348 102262117 ~ 102278883 (+)
LOC110501421 LOC106561865 coding upstream 439971 102184359 ~ 102238260 (+)
LOC110502669 LOC107698134 coding upstream 510410 102038038 ~ 102167821 (+)
slc24a1 LOC106561848 coding downstream 4360 102682822 ~ 102721240 (+)
LOC110501485 LOC106591986 coding downstream 57075 102735537 ~ 102756512 (+)
c2h15orf61 cssa10h15orf61 coding downstream 177428 102855890 ~ 102857341 (+)
skor1b LOC106561870 coding downstream 391271 103069733 ~ 103083283 (+)
pias1b LOC106584817 coding downstream 408897 103087359 ~ 103125059 (+)
G213633 LOC106604990 non-coding upstream 6859 102671063 ~ 102671372 (+)
G213213 NA non-coding upstream 103438 102574084 ~ 102574793 (+)
G213114 NA non-coding upstream 146610 102529572 ~ 102531621 (+)
G213191 NA non-coding upstream 149492 102522082 ~ 102528739 (+)
G213180 NA non-coding upstream 169353 102508536 ~ 102508878 (+)
G213646 NA non-coding downstream 2777 102681239 ~ 102681446 (+)
G213669 NA non-coding downstream 53169 102731631 ~ 102731925 (+)
G213679 NA non-coding downstream 81189 102759651 ~ 102760006 (+)
G213680 NA non-coding downstream 81682 102760144 ~ 102760391 (+)
G213683 NA non-coding downstream 83185 102761647 ~ 102761971 (+)
G213221 NA other upstream 78365 102595531 ~ 102599866 (+)
G213185 NA other upstream 161929 102514207 ~ 102516302 (+)
G213055 NA other upstream 438691 102238303 ~ 102239540 (+)
G213051 NA other upstream 500313 102177409 ~ 102177918 (+)
G212863 NA other upstream 932257 101742899 ~ 101745974 (+)
G213645 NA other downstream 913 102679375 ~ 102680096 (+)
G213775 NA other downstream 385855 103064317 ~ 103065327 (+)

Expression

G213643 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G213643 Expression in each Bioproject

Bar chart with 17 bars.
G213643 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network