G213645



Basic Information


Item Value
gene id G213645
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 102679375 ~ 102680096 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU242668
atagggtcagaaggatagtagatggacctggctacatagggtcagaagaatagtagatgggacctggctacatagggtcaaaaggatagtagatgggacctggctacatagggtcagaaggatagtagatgggacctggctacatagggtcagaaggatagtagatggacctggctacatagggtcagaaggatagtagatggacctggctacatatggtcagaaggatagtagatggacctggctacatagggtcagaaggatagtagatggacctggctacatatggtcagaaggatagtagatggacctggctacatagggtcagaaggatagtagatgggacctggctacatagggtcagaaggatagtagatgggacctggctacatagggtcagaaggatagtagatgggacctggctacatagggtcagaaggatattagatgggacctgggtcagaaggatagtagatgggacctggctacatagggtcagaaggatagtagatgggacctggctatatagggtcagaaggatagtagatggacctggctacaaaggtcagaaggatagtagatggacctggctacatatggtcagaaggatagtagatggacctggctacataggctcagaaggatagtagatggacctggctacatatggtcagaaggatagtagatggacctggctacatagggtcagaaggatagtagat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU242668 True 722 TUCP 0.48 1 102679375 102680096
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118936918 NA coding upstream 71042 102600618 ~ 102608333 (+)
LOC110501451 LOC106561861 coding upstream 364941 102307497 ~ 102314434 (+)
LOC110501429 LOC106561864 coding upstream 400492 102262117 ~ 102278883 (+)
LOC110501421 LOC106561865 coding upstream 441115 102184359 ~ 102238260 (+)
LOC110502669 LOC107698134 coding upstream 511554 102038038 ~ 102167821 (+)
slc24a1 LOC106561848 coding downstream 2726 102682822 ~ 102721240 (+)
LOC110501485 LOC106591986 coding downstream 55441 102735537 ~ 102756512 (+)
c2h15orf61 cssa10h15orf61 coding downstream 175794 102855890 ~ 102857341 (+)
skor1b LOC106561870 coding downstream 389637 103069733 ~ 103083283 (+)
pias1b LOC106584817 coding downstream 407263 103087359 ~ 103125059 (+)
G213643 NA non-coding upstream 913 102678231 ~ 102678462 (+)
G213633 LOC106604990 non-coding upstream 8003 102671063 ~ 102671372 (+)
G213213 NA non-coding upstream 104582 102574084 ~ 102574793 (+)
G213114 NA non-coding upstream 147754 102529572 ~ 102531621 (+)
G213191 NA non-coding upstream 150636 102522082 ~ 102528739 (+)
G213646 NA non-coding downstream 1143 102681239 ~ 102681446 (+)
G213669 NA non-coding downstream 51535 102731631 ~ 102731925 (+)
G213679 NA non-coding downstream 79555 102759651 ~ 102760006 (+)
G213680 NA non-coding downstream 80048 102760144 ~ 102760391 (+)
G213683 NA non-coding downstream 81551 102761647 ~ 102761971 (+)
G213221 NA other upstream 79509 102595531 ~ 102599866 (+)
G213185 NA other upstream 163073 102514207 ~ 102516302 (+)
G213055 NA other upstream 439835 102238303 ~ 102239540 (+)
G213051 NA other upstream 501457 102177409 ~ 102177918 (+)
G212863 NA other upstream 933401 101742899 ~ 101745974 (+)
G213775 NA other downstream 384221 103064317 ~ 103065327 (+)

Expression


G213645 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G213645 Expression in each Bioproject

Bar chart with 18 bars.
G213645 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network