mapip (LOC106580651)



Basic Information


Item Value
gene id mapip
gene name LOC106580651
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 24331526 ~ 24336143 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>NM_001160633.2
GGAAGTTGAAGGGGTCAGCTGACTGGATTGTTATTGAAGAAGTCACTGAACTGGGTGATAATATACATTTCATCATAATTTCGCCTAAATTAATCGAGTTGCTGCAAAGTATTGCTCACTCCAACCATGTTGCGGCCAAAAGCATTGACGCAAGTTCTCAGCCAGGCAAATACAAGCGGAGTACAAAGCACACTATTGTTAAACAATGAAGGGTCTCTTTTGGCTTACTCTGGCTATGGGGACACTGACGCTCGAGTGACCGCTGCCATCGCAAGCAACATCTGGTCGGCCTATGACAAGAATGGGCATCAAGCTTTTAACGAAGATAAACTCAAATTCATTCTGATGGATTGCATGGAAGGCAGGGTGGCCATTACACGGGTAGCTAACCTACTGTTGTGCATGTATGCCAAAGAGACTGTGGGCTTTGGAATGCTTAAAGCCAAGGCTGAAGCACTGGTGCTTTATCTGGAGGAACCTTTAACCCAAGTTGCTGCATCATAGGGGAAGTCTGGCTGGAGCGTTGTCTTCCATTTTGTCTCCCCTGAACATACATGAACTCTTATTGCTGATGTGAATGCTTTACCTGGTCTTCATGAACCACTGCAGTCTGTGTATCAATGAACTGAGTATTTATCTTCTGATTACTATATTTATACTCAATATGCTCTAACTTAATGCTTGAGTTTTTAGTAATTTGGCCTTTTGTGGCATGCAGTTCAAACGTCAAGCTCATACTTTGTGTAAGGCTGGCTAGGTAAATCTTTGAGATTCAAGAGGACTGCTGAAAATGCTGACACATTAACGTTAAGGCATTCACTGTTTACCCTAGTCAGAATCTTACAGTTGTCTGTTCCTGTCACGCAATAAAATGTATGATATCCCTTTG

Function


NR:

description
PREDICTED: ragulator complex protein LAMTOR2

GO:

id name namespace
GO:0043087 regulation of GTPase activity biological_process
GO:0034613 cellular protein localization biological_process
GO:0071230 cellular response to amino acid stimulus biological_process
GO:0032008 positive regulation of TOR signaling biological_process
GO:0016049 cell growth biological_process
GO:0005765 lysosomal membrane cellular_component
GO:0071986 Ragulator complex cellular_component
GO:0005085 guanyl-nucleotide exchange factor activity molecular_function

KEGG:

id description
K20398 LAMTOR2; ragulator complex protein LAMTOR2

RNA


RNA id representative length rna type GC content exon number start site end site
NM_001160633.2 True 889 mRNA 0.43 4 24331526 24336143

Neighbor


gene id symbol gene type direction distance location
LOC110514960 raa2a coding downstream 612 24320744 ~ 24330914 (-)
LOC110514944 LOC106580659 coding downstream 7710 24313555 ~ 24323816 (-)
LOC110514890 LOC106580679 coding downstream 44908 24259081 ~ 24286618 (-)
gpatch4 gpatch4 coding downstream 109799 24217505 ~ 24221727 (-)
LOC110514831 nes coding downstream 132713 24189209 ~ 24198813 (-)
LOC110514914 LOC106605242 coding upstream 581 24336724 ~ 24342873 (-)
LOC110514995 LOC106580635 coding upstream 25340 24361483 ~ 24378365 (-)
LOC110514973 LOC106580622 coding upstream 37658 24373801 ~ 24378081 (-)
LOC110515008 LOC106605295 coding upstream 52898 24389041 ~ 24391115 (-)
LOC110515020 LOC106581398 coding upstream 64561 24400704 ~ 24498985 (-)
G237723 NA non-coding downstream 22515 24305682 ~ 24309011 (-)
G237714 LOC106605309 non-coding downstream 30873 24300193 ~ 24300653 (-)
G237705 NA non-coding downstream 45736 24285557 ~ 24285790 (-)
G237703 NA non-coding downstream 47097 24284199 ~ 24284429 (-)
G237701 LOC106605310 non-coding downstream 75061 24255885 ~ 24256465 (-)
G237732 NA non-coding upstream 12963 24349106 ~ 24349359 (-)
G237828 NA non-coding upstream 177968 24514111 ~ 24514321 (-)
G237829 NA non-coding upstream 179052 24515195 ~ 24515433 (-)
G237837 NA non-coding upstream 190641 24526784 ~ 24526988 (-)
G237838 NA non-coding upstream 191157 24527300 ~ 24527563 (-)
G237657 LOC106605316 other downstream 147562 24180556 ~ 24183964 (-)
LOC110514600 ensa other downstream 551391 23771511 ~ 23780158 (-)
G237047 NA other downstream 1142495 23157109 ~ 23189031 (-)
G235881 NA other downstream 1756537 22573833 ~ 22574989 (-)
LOC118946878 NA other downstream 2576025 21744425 ~ 21755710 (-)
G237832 NA other upstream 185076 24521219 ~ 24521544 (-)
LOC110515154 LOC106605289 other upstream 433419 24767049 ~ 24799511 (-)
LOC110515208 LOC106581894 other upstream 600373 24936516 ~ 25052970 (-)
LOC110515384 LOC106582009 other upstream 862945 25171287 ~ 25236536 (-)
LOC110515750 LOC106582146 other upstream 1487213 25822812 ~ 25825108 (-)

Expression



Co-expression Network