LOC118964376



Basic Information


Item Value
gene id LOC118964376
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 30337723 ~ 30337885 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005051424.1
ATGCACCAGATATGGACCCGGCTGTCCTCAGCACCAGTACACACTGGTGTCTGAGTTCCGTGATTGTTGGGTTTTAAGAAAGGTGCCACAGAAACAGCAGCCCTGATATTTAAGCTCATGAGTGTGAAGGTGCACTCTTGAGTTATGGCTCAGAGGCACAGTG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005051424.1 True 163 mRNA 0.50 1 30337723 30337885
Loading

Neighbor


gene id symbol gene type direction distance location
rpa2 rpa2 coding upstream 14152 30310185 ~ 30323571 (+)
LOC110517644 NA coding upstream 44502 30289328 ~ 30293221 (+)
LOC110504010 LOC106583270 coding upstream 56151 30261103 ~ 30281572 (+)
LOC110517635 LOC106583263 coding upstream 116739 30218320 ~ 30220984 (+)
LOC110517613 LOC106583245 coding upstream 120030 30196595 ~ 30217693 (+)
LOC110517739 med18 coding downstream 25276 30363161 ~ 30367437 (+)
LOC110504017 LOC106583301 coding downstream 37690 30375575 ~ 30412306 (+)
LOC110517766 LOC106605102 coding downstream 210686 30548571 ~ 30576208 (+)
LOC118964363 NA coding downstream 274507 30612392 ~ 30612447 (+)
LOC110517876 LOC106583352 coding downstream 277313 30615198 ~ 30627079 (+)
G244447 NA non-coding upstream 30878 30303389 ~ 30306845 (+)
G244446 NA non-coding upstream 49937 30286007 ~ 30287786 (+)
G244445 NA non-coding upstream 53545 30283829 ~ 30284178 (+)
G244443 NA non-coding upstream 54765 30282533 ~ 30282958 (+)
G244433 LOC106583306 non-coding downstream 20934 30358819 ~ 30359857 (+)
G244466 NA non-coding downstream 37006 30374891 ~ 30375142 (+)
G244481 NA non-coding downstream 57768 30395653 ~ 30395929 (+)
G244482 NA non-coding downstream 59248 30397133 ~ 30397350 (+)
G244487 NA non-coding downstream 69140 30407025 ~ 30407245 (+)
G244292 LOC106583212 other upstream 200159 30132399 ~ 30137564 (+)
G243679 LOC107756720 other upstream 646927 29668379 ~ 29690796 (+)
LOC110517275 LOC106583018 other upstream 1303009 28995823 ~ 29034924 (+)
LOC110516993 LOC106605183 other upstream 2587997 27725189 ~ 27749972 (+)
LOC110516984 NA other upstream 2613929 27705985 ~ 27723794 (+)
G244691 NA other downstream 293885 30631770 ~ 30632533 (+)
G244851 cep85 other downstream 527681 30865566 ~ 30874608 (+)
LOC110518244 LOC106583484 other downstream 580146 30918022 ~ 30924289 (+)
LOC110518266 LOC106583495 other downstream 606853 30939321 ~ 31127608 (+)
G244956 NA other downstream 698632 31036517 ~ 31037252 (+)

Expression


LOC118964376 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

LOC118964376 Expression in each Bioproject

Bar chart with 15 bars.
LOC118964376 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network