G222121 (arnt)


Basic Information

Item Value
gene id G222121
gene name arnt
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 9106017 ~ 9106234 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU253620
TTGGCGTTGGTACAGATGATGTACTCTATCTCCTCAGAGAAGGGGTTCTGGAAGGTGAAGGAGCTGGTCCTGATCCAGAGCCAGTCTCTGGTCTTGGACAGGAAGCGGAACATGACGGACAGCACCTGACCCTTCAGCTTGACCACCTGCTGGAAGCTGTCTCTCAGCAGTTCCTGGTCCTCAGGGTGGGCCAGCTCCAAGATGTTCTTACCCAGCAG

Function

symbol description
arnt Enables sequence-specific DNA binding activity. Acts upstream of or within positive regulation of transcription, DNA-templated; response to toxic substance; and response to xenobiotic stimulus. Predicted to be located in cytoplasm. Predicted to be part of aryl hydrocarbon receptor complex. Predicted to be active in nucleus. Human ortholog(s) of this gene implicated in renal cell carcinoma. Orthologous to human ARNT (aryl hydrocarbon receptor nuclear translocator).

NR:

description
aryl hydrocarbon receptor nuclear translocator protein isoform a

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU253620 True 218 lncRNA 0.35 1 9106017 9106234

Neighbor

gene id symbol gene type direction distance location
LOC110520813 LOC106605815 coding upstream 118171 8982594 ~ 8987846 (+)
LOC110517169 LOC106605893 coding upstream 167319 8932771 ~ 8938698 (+)
LOC118945318 LOC106575331 coding upstream 179960 8898021 ~ 8926057 (+)
LOC110520801 LOC106605893 coding upstream 193707 8906566 ~ 8912310 (+)
LOC110516768 LOC106605893 coding upstream 227364 8865764 ~ 8878653 (+)
LOC110520819 LOC106575022 coding downstream 357103 9463337 ~ 9483086 (+)
LOC118944441 NA coding downstream 379366 9485600 ~ 9486125 (+)
LOC110520820 LOC107573682 coding downstream 384099 9490333 ~ 9508263 (+)
LOC118945352 NA coding downstream 506660 9612894 ~ 9622952 (+)
LOC110536529 LOC106573824 coding downstream 582830 9688881 ~ 9692007 (+)
G222119 NA non-coding upstream 2880 9097272 ~ 9103137 (+)
G222114 NA non-coding upstream 12895 9092369 ~ 9093122 (+)
G222111 NA non-coding upstream 18824 9086988 ~ 9087193 (+)
G222108 NA non-coding upstream 33476 9072134 ~ 9072541 (+)
G222101 NA non-coding upstream 41377 9064415 ~ 9064640 (+)
G222122 NA non-coding downstream 606 9106840 ~ 9107133 (+)
G222123 NA non-coding downstream 1268 9107502 ~ 9107702 (+)
G222128 LOC105018976 non-coding downstream 9604 9115838 ~ 9165250 (+)
G222104 NA non-coding downstream 12611 9118845 ~ 9121340 (+)
G222103 NA non-coding downstream 15553 9121787 ~ 9122493 (+)
G222102 NA other upstream 37866 9067146 ~ 9068151 (+)
G222089 NA other upstream 70184 9035358 ~ 9035833 (+)
G221526 LOC106591640 other upstream 197289 8840224 ~ 8908728 (+)
G222287 NA other downstream 338813 9445047 ~ 9445704 (+)
G222345 LOC106594812 other downstream 500071 9606305 ~ 9611139 (+)
G222353 LOC106573525 other downstream 573526 9679760 ~ 9681752 (+)
sphk2 LOC106605743 other downstream 796878 9900809 ~ 9916529 (+)

Expression


Co-expression Network