G222529



Basic Information


Item Value
gene id G222529
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 9293589 ~ 9293829 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU254148
gtgtatgtaaagaatgataaggcaagaaaagattacaaaatgaagctccttatggaaaatgggaacatcagcaaccttatcttccacacaaaccatcccctggcatggcacagtgctatattagcacactacccctttgttaagagagggggtgttaacgaggggtggaaactcagaatacttgataacgaggactctgagtcagctaatataaacctctataagtctggaacagtaatgg

Function


NR:

description
PREDICTED: uncharacterized protein LOC109098287

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU254148 True 241 lncRNA 0.45 1 9293589 9293829
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110508553 LOC105018974 coding downstream 61631 9160983 ~ 9231958 (-)
LOC110500119 LOC105018975 coding downstream 142598 9122222 ~ 9150991 (-)
LOC110501040 LOC106605812 coding downstream 175152 9101425 ~ 9118437 (-)
LOC110520814 LOC106595728 coding downstream 242727 8988084 ~ 9050862 (-)
LOC110520856 LOC106591015 coding downstream 311306 8973956 ~ 8982283 (-)
LOC118945333 NA coding upstream 25817 9319354 ~ 9389195 (-)
LOC110520816 LOC100380759 coding upstream 53322 9347151 ~ 9371934 (-)
rprd2b LOC106605802 coding upstream 82670 9376499 ~ 9390272 (-)
LOC110508575 prpf3 coding upstream 96458 9390287 ~ 9401122 (-)
LOC110508582 LOC106575046 coding upstream 152435 9446264 ~ 9451249 (-)
G222522 NA non-coding downstream 16284 9275205 ~ 9277305 (-)
G222519 NA non-coding downstream 38688 9254401 ~ 9254901 (-)
G222518 NA non-coding downstream 40584 9252721 ~ 9253005 (-)
G222517 NA non-coding downstream 46066 9246053 ~ 9247523 (-)
G222500 NA non-coding downstream 63262 9229444 ~ 9230327 (-)
G222532 NA non-coding upstream 6022 9299851 ~ 9300060 (-)
G222538 NA non-coding upstream 11885 9305714 ~ 9305921 (-)
G222539 NA non-coding upstream 12600 9306429 ~ 9306744 (-)
G222540 NA non-coding upstream 13397 9307226 ~ 9307479 (-)
G222545 NA non-coding upstream 22324 9316153 ~ 9316521 (-)
G222465 NA other downstream 198373 9093180 ~ 9095216 (-)
G222023 LOC100136250 other downstream 344402 8853817 ~ 8949187 (-)
LOC110520835 ash1l other downstream 472522 8804651 ~ 8839679 (-)
G221986 NA other downstream 529705 8763119 ~ 8763884 (-)
G222607 LOC106574954 other upstream 200967 9494796 ~ 9496853 (-)
LOC110508584 LOC104949237 other upstream 237345 9528874 ~ 9551643 (-)
LOC110520821 LOC106574299 other upstream 267916 9559133 ~ 9594654 (-)
G222662 NA other upstream 323796 9617625 ~ 9622934 (-)
LOC118944443 LOC106573533 other upstream 378614 9665862 ~ 9673439 (-)

Expression


G222529 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G222529 Expression in each Bioproject

Bar chart with 16 bars.
G222529 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network