G222547



Basic Information


Item Value
gene id G222547
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 9317833 ~ 9319323 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU254174
tagtataccagtagttaactaggacgtggttcctgtatgagtgtagagttagtaacaccagtattaactaggagctggttcctgtatgagtgtagagttagtaacaccagtagttaactaagaggtggttcctgtatgagtgtagttagtaacaccagtattaactaggagctggttcctgtatgagtgtagagttagtaacaccagtagttaactaggaggtggttcctgtatgagtgtagagttagtaacaccagtattaactaggaggtggttcctgtatgagtgtagagttagtaacaccagtattaactaggagctggttcctgtatgagtgtagagttagtaacac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU254174 True 352 lncRNA 0.41 2 9317833 9319323
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110508553 LOC105018974 coding downstream 85875 9160983 ~ 9231958 (-)
LOC110500119 LOC105018975 coding downstream 166842 9122222 ~ 9150991 (-)
LOC110501040 LOC106605812 coding downstream 199396 9101425 ~ 9118437 (-)
LOC110520814 LOC106595728 coding downstream 266971 8988084 ~ 9050862 (-)
LOC110520856 LOC106591015 coding downstream 335550 8973956 ~ 8982283 (-)
LOC118945333 NA coding upstream 323 9319354 ~ 9389195 (-)
LOC110520816 LOC100380759 coding upstream 27828 9347151 ~ 9371934 (-)
rprd2b LOC106605802 coding upstream 57176 9376499 ~ 9390272 (-)
LOC110508575 prpf3 coding upstream 70964 9390287 ~ 9401122 (-)
LOC110508582 LOC106575046 coding upstream 126941 9446264 ~ 9451249 (-)
G222545 NA non-coding downstream 1312 9316153 ~ 9316521 (-)
G222540 NA non-coding downstream 10354 9307226 ~ 9307479 (-)
G222539 NA non-coding downstream 11089 9306429 ~ 9306744 (-)
G222538 NA non-coding downstream 11912 9305714 ~ 9305921 (-)
G222532 NA non-coding downstream 17773 9299851 ~ 9300060 (-)
G222573 NA non-coding upstream 82300 9401623 ~ 9401866 (-)
G222574 NA non-coding upstream 82814 9402137 ~ 9402559 (-)
G222576 NA non-coding upstream 85344 9404667 ~ 9404887 (-)
G222465 NA other downstream 222617 9093180 ~ 9095216 (-)
G222023 LOC100136250 other downstream 368646 8853817 ~ 8949187 (-)
LOC110520835 ash1l other downstream 496766 8804651 ~ 8839679 (-)
G221986 NA other downstream 553949 8763119 ~ 8763884 (-)
G222607 LOC106574954 other upstream 175473 9494796 ~ 9496853 (-)
LOC110508584 LOC104949237 other upstream 211851 9528874 ~ 9551643 (-)
LOC110520821 LOC106574299 other upstream 242422 9559133 ~ 9594654 (-)
G222662 NA other upstream 298302 9617625 ~ 9622934 (-)
LOC118944443 LOC106573533 other upstream 353120 9665862 ~ 9673439 (-)

Expression


G222547 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G222547 Expression in each Bioproject

Bar chart with 17 bars.
G222547 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network