G222586



Basic Information


Item Value
gene id G222586
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 9424179 ~ 9424465 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU254213
gtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttggggctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU254213 True 287 lncRNA 0.40 1 9424179 9424465

Neighbor


gene id symbol gene type direction distance location
LOC110508575 prpf3 coding downstream 23057 9390287 ~ 9401122 (-)
rprd2b LOC106605802 coding downstream 33907 9376499 ~ 9390272 (-)
LOC110520816 LOC100380759 coding downstream 52245 9347151 ~ 9371934 (-)
LOC110508538 LOC106594717 coding downstream 90842 9233449 ~ 9333337 (-)
LOC110508582 LOC106575046 coding upstream 21799 9446264 ~ 9451249 (-)
LOC110508594 LOC106605789 coding upstream 91443 9515908 ~ 9525313 (-)
LOC110508584 LOC104949237 coding upstream 104409 9528874 ~ 9551643 (-)
LOC110520821 LOC106574299 coding upstream 134668 9559133 ~ 9594654 (-)
LOC110536519 LOC106573729 coding upstream 178736 9603201 ~ 9641233 (-)
G222582 NA non-coding downstream 12476 9411477 ~ 9411703 (-)
G222579 NA non-coding downstream 17497 9406376 ~ 9406682 (-)
G222576 NA non-coding downstream 19292 9404667 ~ 9404887 (-)
G222574 NA non-coding downstream 21620 9402137 ~ 9402559 (-)
G222573 NA non-coding downstream 22313 9401623 ~ 9401866 (-)
G222505 NA non-coding upstream 17336 9441801 ~ 9444852 (-)
G222511 NA non-coding upstream 20572 9445037 ~ 9445702 (-)
G222600 NA non-coding upstream 49575 9474040 ~ 9476900 (-)
G222607 LOC106574954 non-coding upstream 71361 9494796 ~ 9496853 (-)
G222657 NA non-coding upstream 170555 9595020 ~ 9595330 (-)
LOC110501040 LOC106605812 other downstream 305806 9101425 ~ 9118437 (-)
G222465 NA other downstream 328963 9093180 ~ 9095216 (-)
G222023 LOC100136250 other downstream 474992 8853817 ~ 8949187 (-)
LOC110520835 ash1l other downstream 603112 8804651 ~ 8839679 (-)
G221986 NA other downstream 660295 8763119 ~ 8763884 (-)
G222662 NA other upstream 193160 9617625 ~ 9622934 (-)
LOC118944443 LOC106573533 other upstream 247978 9665862 ~ 9673439 (-)

Expression


G222586 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G222586 Expression in each Bioproject

Bar chart with 19 bars.
G222586 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network