G222366



Basic Information


Item Value
gene id G222366
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 9646171 ~ 9669060 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU253912
cagagagagagagagagagagagagagagagagggggggacagagagagagagagggggggacagagagagagagaggggggggcagagagagagaaagggggggacagagagagagggggggacagagagagagggggaggacagagagagagagagggggggacagagagagagggggggacagagagagagagggggggacagagagagagagggggggacagagagagagggtgggggcagagagagagggggggacagagagagagagggggggacagagagagagaggggggccagagagaggggggggcagagagagagaggggggacagagagagagagggggggacagagagagagagggggg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU253912 True 372 lncRNA 0.65 2 9646171 9669060
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118945352 NA coding upstream 23219 9612894 ~ 9622952 (+)
LOC110520820 LOC107573682 coding upstream 137908 9490333 ~ 9508263 (+)
LOC118944441 NA coding upstream 160046 9485600 ~ 9486125 (+)
LOC110520819 LOC106575022 coding upstream 163085 9463337 ~ 9483086 (+)
LOC110520813 LOC106605815 coding upstream 658325 8982594 ~ 8987846 (+)
LOC110536529 LOC106573824 coding downstream 20004 9688881 ~ 9692007 (+)
LOC110536497 LOC106574921 coding downstream 56315 9725375 ~ 9764307 (+)
LOC110508601 LOC105018956 coding downstream 99740 9768800 ~ 9882291 (+)
LOC110520822 LOC106605747 coding downstream 217811 9886871 ~ 9888193 (+)
LOC110508611 rpl18 coding downstream 224201 9893261 ~ 9900476 (+)
G222346 NA non-coding upstream 33497 9603200 ~ 9612674 (+)
G222349 NA non-coding upstream 52119 9592937 ~ 9594052 (+)
G222342 NA non-coding upstream 61571 9584216 ~ 9584600 (+)
G222339 NA non-coding upstream 73435 9572530 ~ 9572736 (+)
G222381 NA non-coding downstream 9969 9679029 ~ 9679295 (+)
G222354 NA non-coding downstream 12912 9681972 ~ 9683128 (+)
G222388 NA non-coding downstream 32948 9702008 ~ 9702574 (+)
G222723 NA non-coding downstream 96861 9765921 ~ 9767809 (+)
G222345 LOC106594812 other upstream 35032 9606305 ~ 9611139 (+)
G222287 NA other upstream 200467 9445047 ~ 9445704 (+)
G222102 NA other upstream 578020 9067146 ~ 9068151 (+)
G222089 NA other upstream 610338 9035358 ~ 9035833 (+)
G222353 LOC106573525 other downstream 10700 9679760 ~ 9681752 (+)
sphk2 LOC106605743 other downstream 234052 9900809 ~ 9916529 (+)
LOC110508845 LOC106605771 other downstream 605065 10267749 ~ 10276176 (+)
LOC110508886 LOC106605776 other downstream 642622 10306848 ~ 10314535 (+)
LOC110520833 LOC106575226 other downstream 1047591 10716613 ~ 10767669 (+)

Expression


G222366 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G222366 Expression in each Bioproject

Bar chart with 13 bars.
G222366 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network