G222354



Basic Information


Item Value
gene id G222354
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 9681972 ~ 9683128 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU253898
TCCCTCGGCGGCCCGGAGGAACTCGGTGGCGGGGGTCCTGAAGCCTCTGGGCCGGGGCTGCCCACAGGGAAGCCTGCACCTGGTATCCCAGCAGACCGCTGTCACTCTCGTCTGGCACCTCCTCCGTGAAGCGTCTTTTCTGCGGCGGATTGGCTAAGACTACAGGAGGCGGAGCTTTGGGCGGAACCGGAGCAGCGGGTGGGAAAGGAGAAGGTGG

Function


NR:

description
PREDICTED: UPF0469 protein KIAA0907 homolog isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU253898 True 217 lncRNA 0.66 2 9681972 9683128

Neighbor


gene id symbol gene type direction distance location
LOC118945352 NA coding upstream 59020 9612894 ~ 9622952 (+)
LOC110520820 LOC107573682 coding upstream 173709 9490333 ~ 9508263 (+)
LOC118944441 NA coding upstream 195847 9485600 ~ 9486125 (+)
LOC110520819 LOC106575022 coding upstream 198886 9463337 ~ 9483086 (+)
LOC110520813 LOC106605815 coding upstream 694126 8982594 ~ 8987846 (+)
LOC110536529 LOC106573824 coding downstream 5936 9688881 ~ 9692007 (+)
LOC110536497 LOC106574921 coding downstream 42247 9725375 ~ 9764307 (+)
LOC110508601 LOC105018956 coding downstream 85672 9768800 ~ 9882291 (+)
LOC110520822 LOC106605747 coding downstream 203743 9886871 ~ 9888193 (+)
LOC110508611 rpl18 coding downstream 210133 9893261 ~ 9900476 (+)
G222381 NA non-coding upstream 2677 9679029 ~ 9679295 (+)
G222366 NA non-coding upstream 12912 9646171 ~ 9669060 (+)
G222371 NA non-coding upstream 24959 9656420 ~ 9657013 (+)
G222346 NA non-coding upstream 69298 9603200 ~ 9612674 (+)
G222388 NA non-coding downstream 18880 9702008 ~ 9702574 (+)
G222723 NA non-coding downstream 82793 9765921 ~ 9767809 (+)
G222741 NA non-coding downstream 123438 9806566 ~ 9807900 (+)
G222743 NA non-coding downstream 124911 9808039 ~ 9809141 (+)
G222353 LOC106573525 other upstream 220 9679760 ~ 9681752 (+)
G222345 LOC106594812 other upstream 70833 9606305 ~ 9611139 (+)
G222287 NA other upstream 236268 9445047 ~ 9445704 (+)
G222102 NA other upstream 613821 9067146 ~ 9068151 (+)
sphk2 LOC106605743 other downstream 219984 9900809 ~ 9916529 (+)
LOC110508845 LOC106605771 other downstream 590997 10267749 ~ 10276176 (+)
LOC110508886 LOC106605776 other downstream 628554 10306848 ~ 10314535 (+)
LOC110520833 LOC106575226 other downstream 1033523 10716613 ~ 10767669 (+)
cacng8b LOC106576929 other downstream 1086545 10769638 ~ 10827279 (+)

Expression


G222354 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

G222354 Expression in each Bioproject

Bar chart with 6 bars.
G222354 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network