G222911



Basic Information


Item Value
gene id G222911
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 10290552 ~ 10290846 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU254611
atcctgctaccagtcacttttcagccctgtttacatgtatatcctgctaccagtcacttttcaaccctgtttacatgtatatcctgctaccagtcacttttcagccatgtttacatgtatatcctgctaccagtcacttttcagccctgtttacatgtatatcctgctaccagtcacttttcagccctgtttacatgtatatcctgctagcagtcacttttcagccctgtttacatgtatatcctgctaccagtcacttttcagccatgtttacatgtatatcctgctaccagtc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU254611 True 295 lncRNA 0.42 1 10290552 10290846
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110508875 LOC106605773 coding upstream 3463 10278141 ~ 10287089 (+)
LOC110508845 LOC106605771 coding upstream 14376 10267749 ~ 10276176 (+)
LOC110508861 NA coding upstream 23650 10245328 ~ 10266902 (+)
LOC110508838 ube2s coding upstream 50588 10233152 ~ 10239964 (+)
LOC110508830 LOC106592928 coding upstream 63716 10180438 ~ 10226836 (+)
LOC110520828 NA coding downstream 4618 10295464 ~ 10306199 (+)
LOC110508886 LOC106605776 coding downstream 16002 10306848 ~ 10314535 (+)
LOC110508924 LOC106605777 coding downstream 50083 10340929 ~ 10363673 (+)
LOC110520829 LOC102782376 coding downstream 140912 10431758 ~ 10605056 (+)
prkcg LOC105019084 coding downstream 370244 10661090 ~ 10701728 (+)
G222910 NA non-coding upstream 923 10289421 ~ 10289629 (+)
G222879 NA non-coding upstream 136857 10153218 ~ 10153695 (+)
G222875 grwd1 non-coding upstream 140404 10149049 ~ 10150148 (+)
G222858 NA non-coding upstream 161309 10129028 ~ 10129243 (+)
G222916 NA non-coding downstream 8302 10299148 ~ 10299461 (+)
G222918 NA non-coding downstream 11358 10302204 ~ 10303215 (+)
G222919 NA non-coding downstream 14018 10304864 ~ 10305088 (+)
G222938 NA non-coding downstream 44997 10335843 ~ 10336320 (+)
sphk2 LOC106605743 other upstream 377454 9900809 ~ 9916529 (+)
G222353 LOC106573525 other upstream 608800 9679760 ~ 9681752 (+)
G222345 LOC106594812 other upstream 679413 9606305 ~ 9611139 (+)
LOC110520820 LOC107573682 other upstream 783766 9490333 ~ 9508263 (+)
LOC110520833 LOC106575226 other downstream 425805 10716613 ~ 10767669 (+)
cacng8b LOC106576929 other downstream 478827 10769638 ~ 10827279 (+)
G223418 u2af2 other downstream 562856 10853702 ~ 10856200 (+)
LOC110508993 LOC106576906 other downstream 585911 10876757 ~ 10878635 (+)

Expression


G222911 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G222911 Expression in each Bioproject

Bar chart with 12 bars.
G222911 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network