G222939



Basic Information


Item Value
gene id G222939
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 10336383 ~ 10336717 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU254646
ggctagtgataaatttacataatttcccatcaattcccatttttcaagtggctggagttgagtcagtgtcagtgtcagtgtgttggcagcagccactcaatgttagtggtggctgtttaacagtctgatggccttgagatagaagcagtttttcagtctctcggtcccagctttgatgcacctgtactgacctcgccttctggatgatagcggggtgaacaggcagtggctcgggtggttgatgtccttgatgatctttatggccttcctgtaacatcgggtggtgtaggtgtcctggagggcaggtagtttgcccccggtgatgcgttgtgcag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU254646 True 335 lncRNA 0.50 1 10336383 10336717
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110508886 LOC106605776 coding upstream 21848 10306848 ~ 10314535 (+)
LOC110520828 NA coding upstream 30184 10295464 ~ 10306199 (+)
LOC110508875 LOC106605773 coding upstream 49294 10278141 ~ 10287089 (+)
LOC110508845 LOC106605771 coding upstream 60207 10267749 ~ 10276176 (+)
LOC110508861 NA coding upstream 69481 10245328 ~ 10266902 (+)
LOC110508924 LOC106605777 coding downstream 4212 10340929 ~ 10363673 (+)
LOC110520829 LOC102782376 coding downstream 95041 10431758 ~ 10605056 (+)
prkcg LOC105019084 coding downstream 324373 10661090 ~ 10701728 (+)
LOC110520833 LOC106575226 coding downstream 379896 10716613 ~ 10767669 (+)
cacng8b LOC106576929 coding downstream 432921 10769638 ~ 10827279 (+)
G222938 NA non-coding upstream 63 10335843 ~ 10336320 (+)
G222919 NA non-coding upstream 31295 10304864 ~ 10305088 (+)
G222918 NA non-coding upstream 33168 10302204 ~ 10303215 (+)
G222916 NA non-coding upstream 36922 10299148 ~ 10299461 (+)
G222940 NA non-coding downstream 652 10337369 ~ 10337761 (+)
G223226 NA non-coding downstream 55320 10392037 ~ 10392260 (+)
G223228 NA non-coding downstream 56662 10393379 ~ 10393580 (+)
G223232 NA non-coding downstream 59652 10396369 ~ 10397146 (+)
G223238 NA non-coding downstream 73126 10409843 ~ 10410469 (+)
sphk2 LOC106605743 other upstream 423285 9900809 ~ 9916529 (+)
G222353 LOC106573525 other upstream 654631 9679760 ~ 9681752 (+)
G222345 LOC106594812 other upstream 725244 9606305 ~ 9611139 (+)
G223418 u2af2 other downstream 516985 10853702 ~ 10856200 (+)
LOC110508993 LOC106576906 other downstream 540040 10876757 ~ 10878635 (+)
G223434 LOC106595748 other downstream 613432 10950149 ~ 10952739 (+)

Expression


G222939 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G222939 Expression in each Bioproject

Bar chart with 19 bars.
G222939 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network