G222940



Basic Information


Item Value
gene id G222940
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 10337369 ~ 10337761 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU254647
gacccagggtctcgagcttgatgacgagcttggagggtactatggtgttgaataccgagctgtagtcgatgaacagcattctcacataggtattgctcttgtccagatgggttagggcagtgtgcagtgtggttgagattgcatcgtctgtggacctatttgggcggtaagcaaattggagtgggtctagggtgtcgggtagggtggaggtgatattgtccttgactagtctctcaaagcacttcatgatgacggaagtgagtgctgcggggcggtagtcgtttagctcagttaccttagctttcttgggaacaggaacaatggtggccctcttgaagcatgtgggaacagcagactggtatagggattgattgaatatgtccgtaaacacac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU254647 True 393 lncRNA 0.50 1 10337369 10337761

Neighbor


gene id symbol gene type direction distance location
LOC110508886 LOC106605776 coding upstream 22834 10306848 ~ 10314535 (+)
LOC110520828 NA coding upstream 31170 10295464 ~ 10306199 (+)
LOC110508875 LOC106605773 coding upstream 50280 10278141 ~ 10287089 (+)
LOC110508845 LOC106605771 coding upstream 61193 10267749 ~ 10276176 (+)
LOC110508861 NA coding upstream 70467 10245328 ~ 10266902 (+)
LOC110508924 LOC106605777 coding downstream 3168 10340929 ~ 10363673 (+)
LOC110520829 LOC102782376 coding downstream 93997 10431758 ~ 10605056 (+)
prkcg LOC105019084 coding downstream 323329 10661090 ~ 10701728 (+)
LOC110520833 LOC106575226 coding downstream 378852 10716613 ~ 10767669 (+)
cacng8b LOC106576929 coding downstream 431877 10769638 ~ 10827279 (+)
G222939 NA non-coding upstream 652 10336383 ~ 10336717 (+)
G222938 NA non-coding upstream 1049 10335843 ~ 10336320 (+)
G222919 NA non-coding upstream 32281 10304864 ~ 10305088 (+)
G222918 NA non-coding upstream 34154 10302204 ~ 10303215 (+)
G223226 NA non-coding downstream 54276 10392037 ~ 10392260 (+)
G223228 NA non-coding downstream 55618 10393379 ~ 10393580 (+)
G223232 NA non-coding downstream 58608 10396369 ~ 10397146 (+)
G223238 NA non-coding downstream 72082 10409843 ~ 10410469 (+)
G223276 NA non-coding downstream 132645 10470406 ~ 10514299 (+)
sphk2 LOC106605743 other upstream 424271 9900809 ~ 9916529 (+)
G222353 LOC106573525 other upstream 655617 9679760 ~ 9681752 (+)
G222345 LOC106594812 other upstream 726230 9606305 ~ 9611139 (+)
G223418 u2af2 other downstream 515941 10853702 ~ 10856200 (+)
LOC110508993 LOC106576906 other downstream 538996 10876757 ~ 10878635 (+)
G223434 LOC106595748 other downstream 612388 10950149 ~ 10952739 (+)

Expression


G222940 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G222940 Expression in each Bioproject

Bar chart with 18 bars.
G222940 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network