G225370



Basic Information


Item Value
gene id G225370
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 12841311 ~ 12843899 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU257787
AATCACTCACCCTTACAGTCACACAGTCTGTCATGGTGTCTGTGGGGGTTGATCTGGTCTCCAACTCTCCCTGGGTCCTCCACTGTAGCTTCACTGACACTTGCCCTTGGCCAGTGAATGCCAATACACAGAACAGCAAAAGCATCTTTATTCCCATTCCTCTGGCCACAATATCCTTGTGAATGTGCAATATGATCTCTACAGCTATGACTGACTGAACAACTAACCTCCGCAGTTACTTCAGCCCTTTATATAGACGTGTGTCTCAATCTGAGATAAAATGGGCCATGTTCTATGAAGC

Function


NR:

description
PREDICTED: uncharacterized protein LOC106578929

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU257787 True 301 lncRNA 0.46 2 12841311 12843899
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509869 NA coding downstream 77330 12761519 ~ 12763981 (-)
LOC110509853 NA coding downstream 83131 12753798 ~ 12758180 (-)
LOC118944488 NA coding downstream 87525 12752682 ~ 12753786 (-)
LOC118944453 LOC106605569 coding downstream 95624 12735753 ~ 12745687 (-)
LOC110505108 LOC106578919 coding downstream 108908 12727064 ~ 12732403 (-)
LOC110509927 LOC106578751 coding upstream 12795 12856694 ~ 12860589 (-)
tlr21 LOC106605556 coding upstream 21043 12864942 ~ 12875688 (-)
LOC110503616 LOC106605556 coding upstream 36986 12880885 ~ 12883016 (-)
cxcr3.1 cxcr3b coding upstream 81555 12925454 ~ 12929064 (-)
LOC110510146 mrpl17 coding upstream 495294 13339193 ~ 13341845 (-)
G225368 NA non-coding downstream 18182 12814423 ~ 12823129 (-)
G225371 LOC106578676 non-coding downstream 20236 12814937 ~ 12821075 (-)
G225369 LOC106578676 non-coding downstream 21176 12813999 ~ 12820135 (-)
G225345 LOC106578696 non-coding downstream 60090 12779923 ~ 12781221 (-)
G225292 NA non-coding downstream 167721 12673056 ~ 12673590 (-)
G225391 NA non-coding upstream 3537 12847436 ~ 12847695 (-)
G226019 NA non-coding upstream 67571 12911470 ~ 12912132 (-)
G226055 NA non-coding upstream 113544 12957443 ~ 12957679 (-)
G226067 NA non-coding upstream 127202 12971101 ~ 12971823 (-)
G226065 LOC106605724 non-coding upstream 128659 12972558 ~ 12985792 (-)
G225171 LOC106605713 other downstream 368251 12472299 ~ 12473060 (-)
G225127 LOC106605865 other downstream 383520 12454388 ~ 12457791 (-)
G225099 NA other downstream 500345 12336241 ~ 12340966 (-)
G224988 LOC106605856 other downstream 760078 12071287 ~ 12081233 (-)
G224954 LOC106576536 other downstream 825210 12014926 ~ 12016101 (-)
G226124 NA other upstream 222974 13066873 ~ 13067357 (-)
G226187 NA other upstream 333279 13177178 ~ 13180272 (-)
G226224 NA other upstream 379985 13223884 ~ 13224515 (-)
G226294 LOC100136012 other upstream 500175 13344074 ~ 13344375 (-)
wu:fe05a04 LOC106578221 other upstream 1082775 13909746 ~ 13927861 (-)

Expression


G225370 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 125.
End of interactive chart.

G225370 Expression in each Bioproject

Bar chart with 5 bars.
G225370 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network