G232873



Basic Information


Item Value
gene id G232873
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 19471206 ~ 19471551 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU266238
TCTGTGGGTCAGTATGCTCATGCTATCAGAGGTATTGTAAAACTCTGTGGGTCAGTATGCTCATTCTGTCAGAGGTATTGTATAACTCTGTGGGTCAGTATGCTCATGCTATCAGAGGTATTGTAAAACTCTGTGGGTCAGTATGCTCATTCTGTCAGAGGTATTGTATAACTCTGTGGGTCAGTATGCCCGTACTGTCAGAGGTATTGTAAAACTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU266238 True 217 lncRNA 0.42 2 19471206 19471551
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110511176 LOC106579058 coding downstream 188838 19065512 ~ 19282368 (-)
LOC110511207 oxr1 coding downstream 447054 18826879 ~ 19024152 (-)
LOC110511312 LOC106605543 coding downstream 673837 18793985 ~ 18797369 (-)
LOC110511352 LOC106605528 coding downstream 764732 18697337 ~ 18706474 (-)
LOC110511375 NA coding downstream 794566 18633399 ~ 18676640 (-)
LOC110512409 LOC106605396 coding upstream 183732 19655283 ~ 19667465 (-)
LOC110512480 flot1 coding upstream 290825 19762376 ~ 19785561 (-)
LOC110512516 LOC106579712 coding upstream 371159 19827342 ~ 19851108 (-)
LOC110512609 LOC106579779 coding upstream 405946 19877497 ~ 19895848 (-)
g6f-like-b g6f-like-b coding upstream 442969 19914520 ~ 19931740 (-)
G232802 NA non-coding downstream 62707 19404919 ~ 19408499 (-)
G232835 NA non-coding downstream 82220 19388032 ~ 19388986 (-)
G232105 LOC106597055 non-coding downstream 237689 19225570 ~ 19233517 (-)
G232065 NA non-coding downstream 340223 19130646 ~ 19130983 (-)
G232064 NA non-coding downstream 341450 19129473 ~ 19129756 (-)
G232883 NA non-coding upstream 14261 19485812 ~ 19486777 (-)
G232898 NA non-coding upstream 37628 19509179 ~ 19510193 (-)
G232921 NA non-coding upstream 81584 19553135 ~ 19554542 (-)
G232971 NA non-coding upstream 162413 19633964 ~ 19634713 (-)
G232972 NA non-coding upstream 163256 19634807 ~ 19635142 (-)
G231652 rn146 other downstream 869331 18599730 ~ 18601875 (-)
LOC110503747 lars2 other downstream 1340152 18093704 ~ 18154474 (-)
LOC110505118 LOC106579600 other downstream 1493297 17975160 ~ 17985544 (-)
G229707 NA other downstream 2422862 17043792 ~ 17048344 (-)
rims2a LOC106579570 other upstream 70551 19416054 ~ 19652601 (-)
G232980 NA other upstream 176535 19648086 ~ 19648629 (-)
G233052 LOC106605397 other upstream 284653 19756204 ~ 19757908 (-)
G233513 LOC106561082 other upstream 1080232 20551783 ~ 20551997 (-)
glipr2l LOC106605424 other upstream 1177220 20648378 ~ 20652052 (-)

Expression


G232873 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G232873 Expression in each Bioproject

Bar chart with 11 bars.
G232873 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network