G237832



Basic Information


Item Value
gene id G237832
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 24521219 ~ 24521544 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU271769
TAGGCCTCATCGCTCTGATGGGCTACACCGCTCTAAAGGACTGCGATGACGAAGAGAAGCTTCTTCAAGACTGGGGTGAAAAGATGAAGGATGTACAGGTGAAAATGAATGCTGTCATTGAGGACTGCATCACCAGCTTCCCCAAGCAGTCTGAACTGGATTCCCGGAGGTTGGTTAGGGACCATTCTGACCTGAGCAACCAGCAGCTGGCAGACGCCATTTTGGAGAAGCTGAAAAGAAAGTATGACTGGGTGTGCTGGTCTGTCCGTATATTCAGCTCCCCTTCGGGCCTGTTCTCCAACAAAAAAGACATCCAGTGCCCCACA

Function


NR:

description
uncharacterized protein LOC110514995

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU271769 True 326 TUCP 0.40 1 24521219 24521544

Neighbor


gene id symbol gene type direction distance location
LOC110515020 LOC106581398 coding downstream 22234 24400704 ~ 24498985 (-)
LOC118944659 LOC106581364 coding downstream 36799 24483236 ~ 24484420 (-)
LOC110515008 LOC106605295 coding downstream 130104 24389041 ~ 24391115 (-)
LOC110514995 LOC106580635 coding downstream 142854 24361483 ~ 24378365 (-)
LOC110514973 LOC106580622 coding downstream 143138 24373801 ~ 24378081 (-)
LOC110515051 LOC106581796 coding upstream 44169 24565713 ~ 24576410 (-)
LOC110515085 LOC100380645 coding upstream 81077 24602621 ~ 24619117 (-)
LOC110505156 NA coding upstream 124815 24646359 ~ 24647543 (-)
LOC110515097 LOC106605292 coding upstream 136266 24657810 ~ 24712733 (-)
LOC110515141 LOC106581821 coding upstream 206059 24727603 ~ 24765483 (-)
G237829 NA non-coding downstream 5786 24515195 ~ 24515433 (-)
G237828 NA non-coding downstream 6898 24514111 ~ 24514321 (-)
G237732 NA non-coding downstream 171860 24349106 ~ 24349359 (-)
G237723 NA non-coding downstream 212208 24305682 ~ 24309011 (-)
G237714 LOC106605309 non-coding downstream 220566 24300193 ~ 24300653 (-)
G237837 NA non-coding upstream 5240 24526784 ~ 24526988 (-)
G237838 NA non-coding upstream 5756 24527300 ~ 24527563 (-)
G237840 NA non-coding upstream 6930 24528474 ~ 24528781 (-)
G237849 NA non-coding upstream 8274 24529818 ~ 24530717 (-)
G237850 NA non-coding upstream 10171 24531715 ~ 24532048 (-)
G237657 LOC106605316 other downstream 337255 24180556 ~ 24183964 (-)
LOC110514600 ensa other downstream 741084 23771511 ~ 23780158 (-)
G237047 NA other downstream 1332188 23157109 ~ 23189031 (-)
G235881 NA other downstream 1946230 22573833 ~ 22574989 (-)
LOC118946878 NA other downstream 2765718 21744425 ~ 21755710 (-)
LOC110515154 LOC106605289 other upstream 248018 24767049 ~ 24799511 (-)
LOC110515208 LOC106581894 other upstream 414972 24936516 ~ 25052970 (-)
LOC110515384 LOC106582009 other upstream 677544 25171287 ~ 25236536 (-)
LOC110515750 LOC106582146 other upstream 1301812 25822812 ~ 25825108 (-)
G240409 NA other upstream 2047557 26569101 ~ 26569522 (-)

Expression


G237832 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G237832 Expression in each Bioproject

Bar chart with 14 bars.
G237832 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network