G238494 (tap1)



Basic Information


Item Value
gene id G238494
gene name tap1
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 25129102 ~ 25129653 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU272527
CCAGATTGAGGCTGCGTAGGCTGCTGCTTCCTCTTTATTCAGAGAGTAGGTCTTCTCCAGCCTCTTCCTGTAGCGCTCCGTCTCGCCCTCCTCATTGGCAAAGCTGCGTACTGTCTTCATAGAGGAGAAGGTCTCCGTGGCAACGTCATTGGCCTGGGCTAGTGACTTTTGAACCTTCGCACCGAGTTCCTGGTACCACTTGCCGGGTATCTTTGGTA

Function


symbol description
tap1 Predicted to enable ABC-type peptide transporter activity. Predicted to be involved in peptide transport and transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Human ortholog(s) of this gene implicated in several diseases, including MHC class I deficiency; autoimmune disease (multiple); bronchial disease (multiple); diffuse scleroderma; and lung disease (multiple). Orthologous to human TAP1 (transporter 1, ATP binding cassette subfamily B member).

NR:

description
antigen peptide transporter 1-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU272527 True 218 lncRNA 0.54 2 25129102 25129653

Neighbor


gene id symbol gene type direction distance location
notchl LOC106581966 coding downstream 3660 25119183 ~ 25125442 (-)
LOC110515302 LOC106581964 coding downstream 17986 25107822 ~ 25111116 (-)
LOC110515290 LOC106581956 coding downstream 22466 25101393 ~ 25106636 (-)
LOC110515238 LOC106581944 coding downstream 56438 25058594 ~ 25072664 (-)
LOC110515208 LOC106581894 coding downstream 76132 24936516 ~ 25052970 (-)
LOC110515384 LOC106582009 coding upstream 41634 25171287 ~ 25236536 (-)
LOC110515443 LOC106605270 coding upstream 336198 25465851 ~ 25521829 (-)
LOC110515528 LOC106582056 coding upstream 438386 25568039 ~ 25575807 (-)
LOC110503974 NA coding upstream 454288 25583941 ~ 25589424 (-)
LOC110515569 LOC106605268 coding upstream 467051 25596704 ~ 25643498 (-)
G238414 NA non-coding downstream 197654 24928799 ~ 24931448 (-)
LOC110515154 LOC106605289 non-coding downstream 359771 24767049 ~ 24799511 (-)
LOC110515141 LOC106581821 non-coding downstream 363740 24727603 ~ 24765483 (-)
G238316 NA non-coding downstream 409133 24719736 ~ 24719969 (-)
G238315 LOC106581815 non-coding downstream 410544 24717738 ~ 24718558 (-)
G238509 NA non-coding upstream 19897 25149550 ~ 25149823 (-)
G238588 NA non-coding upstream 48983 25178636 ~ 25178846 (-)
G238593 NA non-coding upstream 59406 25189059 ~ 25189309 (-)
G238623 NA non-coding upstream 108019 25237672 ~ 25237878 (-)
G237832 NA other downstream 607558 24521219 ~ 24521544 (-)
G237657 LOC106605316 other downstream 945138 24180556 ~ 24183964 (-)
LOC110514600 ensa other downstream 1348967 23771511 ~ 23780158 (-)
LOC110515750 LOC106582146 other upstream 693703 25822812 ~ 25825108 (-)
G240409 NA other upstream 1439448 26569101 ~ 26569522 (-)
G240464 NA other upstream 1544939 26674592 ~ 26675033 (-)
LOC110516631 LOC106582601 other upstream 1941402 27070914 ~ 27097259 (-)

Expression



Co-expression Network