G239402



Basic Information


Item Value
gene id G239402
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 25811205 ~ 25813187 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU273577
TGAAATGACTGAAAACATGACTCGGTTGAACCATGACCTCAATATATGAATAGCATTTTCTTACCCACAACCATCAGGGTGAATTCAAAGCCTCTCTTCACTGATTTTCTGTACACTTGATTGGGAAGGCTAGCAAAGCCCACATACCCCTCCAGATTCTTTTGCTCACCCATAATGTTGACGTTCGCTGCCGCTCAGAAACCGATCATTCACAACCCGACATTCCGCTTCTTTACCACTAGCGCATACCTACGTACTATGGCCGACGTAATTTCACACCTGAACGACGGAGAGTACGCCA

Function


NR:

description
septin-7-like isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU273577 True 301 lncRNA 0.49 2 25811205 25813187
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110515676 LOC106582133 coding downstream 557 25800237 ~ 25810648 (-)
LOC110515569 LOC106605268 coding downstream 167707 25596704 ~ 25643498 (-)
LOC110503974 NA coding downstream 221781 25583941 ~ 25589424 (-)
LOC110515528 LOC106582056 coding downstream 235398 25568039 ~ 25575807 (-)
LOC110515443 LOC106605270 coding downstream 289376 25465851 ~ 25521829 (-)
LOC110515750 LOC106582146 coding upstream 9625 25822812 ~ 25825108 (-)
LOC110515765 LOC106582155 coding upstream 24450 25837637 ~ 25854424 (-)
ica1 LOC106582178 coding upstream 70631 25883818 ~ 25895863 (-)
LOC110515870 LOC106584533 coding upstream 98520 25911707 ~ 25918481 (-)
LOC110515882 LOC106582184 coding upstream 105728 25918915 ~ 26024557 (-)
G239138 NA non-coding downstream 219655 25591351 ~ 25591550 (-)
G239133 NA non-coding downstream 232510 25577220 ~ 25578695 (-)
G239050 NA non-coding downstream 269801 25540874 ~ 25541404 (-)
G238922 NA non-coding downstream 346658 25464226 ~ 25464547 (-)
G239480 pngf non-coding upstream 18825 25832012 ~ 25834240 (-)
G239502 NA non-coding upstream 61624 25874811 ~ 25875963 (-)
G239504 NA non-coding upstream 85631 25898818 ~ 25899130 (-)
G239519 NA non-coding upstream 123036 25936223 ~ 25936711 (-)
LOC110515384 LOC106582009 other downstream 574838 25171287 ~ 25236536 (-)
LOC110515208 LOC106581894 other downstream 844997 24936516 ~ 25052970 (-)
LOC110515154 LOC106605289 other downstream 1040882 24767049 ~ 24799511 (-)
G237832 NA other downstream 1289661 24521219 ~ 24521544 (-)
G237657 LOC106605316 other downstream 1627241 24180556 ~ 24183964 (-)
G240409 NA other upstream 755914 26569101 ~ 26569522 (-)
G240464 NA other upstream 861405 26674592 ~ 26675033 (-)
LOC110516631 LOC106582601 other upstream 1257868 27070914 ~ 27097259 (-)
LOC110516667 LOC106582624 other upstream 1298995 27111084 ~ 27127488 (-)

Expression


G239402 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G239402 Expression in each Bioproject

Bar chart with 10 bars.
G239402 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network