G239519



Basic Information


Item Value
gene id G239519
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 25936223 ~ 25936711 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU273721
TGTCTTATTCTCCCTGGTCTGAGTGCAGAGTGGAGGTAGACTACACCACACACTGTCTTATTCTCCCTGGTCTGAGTGCAGAGTGGAGGTAGGCTACACCACACACTGTCTTATTCTCCCTGGTCTGAGTGCCGGGTGGAGGTAGGCTACACCACACACTGTCTTATTCTCCCTGGTCTGAGTGCCGGGTGGAGGTAGGCTACACCACACACTGTCTTATTCTCCCTGGTCTCAGTGCAGAGTGGAGGTAGGCTACACCACACACTGTCTTATTCTC

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU273721 True 277 lncRNA 0.53 2 25936223 25936711

Neighbor


gene id symbol gene type direction distance location
LOC110515870 LOC106584533 coding downstream 17742 25911707 ~ 25918481 (-)
ica1 LOC106582178 coding downstream 40360 25883818 ~ 25895863 (-)
LOC110515765 LOC106582155 coding downstream 81799 25837637 ~ 25854424 (-)
LOC110515750 LOC106582146 coding downstream 111115 25822812 ~ 25825108 (-)
LOC110515676 LOC106582133 coding downstream 125575 25800237 ~ 25810648 (-)
LOC110515898 LOC106582196 coding upstream 134345 26071056 ~ 26094219 (-)
LOC110515941 etv1 coding upstream 230757 26167468 ~ 26186034 (-)
LOC110515948 LOC106582257 coding upstream 252211 26188922 ~ 26252950 (-)
LOC110515972 LOC106582276 coding upstream 339051 26275762 ~ 26316108 (-)
LOC110515986 meox2 coding upstream 380863 26317574 ~ 26331168 (-)
G239504 NA non-coding downstream 37093 25898818 ~ 25899130 (-)
G239502 NA non-coding downstream 60260 25874811 ~ 25875963 (-)
G239480 pngf non-coding downstream 101983 25832012 ~ 25834240 (-)
G239402 NA non-coding downstream 123036 25811205 ~ 25813187 (-)
LOC110515882 LOC106582184 non-coding upstream 45898 25918915 ~ 26024557 (-)
G239515 NA non-coding upstream 118864 26055575 ~ 26057001 (-)
G239822 NA non-coding upstream 189172 26125883 ~ 26126134 (-)
G239836 NA non-coding upstream 209509 26146220 ~ 26146503 (-)
G239853 NA non-coding upstream 250292 26187003 ~ 26187203 (-)
LOC110515384 LOC106582009 other downstream 699856 25171287 ~ 25236536 (-)
LOC110515208 LOC106581894 other downstream 970015 24936516 ~ 25052970 (-)
LOC110515154 LOC106605289 other downstream 1165900 24767049 ~ 24799511 (-)
G237832 NA other downstream 1414679 24521219 ~ 24521544 (-)
G240409 NA other upstream 632390 26569101 ~ 26569522 (-)
G240464 NA other upstream 737881 26674592 ~ 26675033 (-)
LOC110516631 LOC106582601 other upstream 1134344 27070914 ~ 27097259 (-)
LOC110516667 LOC106582624 other upstream 1175471 27111084 ~ 27127488 (-)
LOC110516678 LOC106605187 other upstream 1218857 27154680 ~ 27159987 (-)

Expression


G239519 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G239519 Expression in each Bioproject

Bar chart with 11 bars.
G239519 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network