G239822



Basic Information


Item Value
gene id G239822
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 26125883 ~ 26126134 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU274076
AGTGAAGAAGTGAAGTGTTAGTAGCGGGGTATCAAAACTTCCCAAATCATCCAAGTGAAGTACCAGATTCCACTATTGTGGTATTGCACCTGTAGTTATCTCATCTGTGACCACATTTGTAGGATGAAATGCACCTGCATTAGTGGAATCTGTATGACAATTACGATCTCTATTGAGCTCATGTTCAAGGGGAGATAGGTACTGAACTGGCCTTGCCCTTGATGAGGGTGGATGATGGACAACACCTAACTG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU274076 True 252 lncRNA 0.43 1 26125883 26126134
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110515898 LOC106582196 coding downstream 31664 26071056 ~ 26094219 (-)
LOC110515882 LOC106582184 coding downstream 101326 25918915 ~ 26024557 (-)
LOC110515870 LOC106584533 coding downstream 207402 25911707 ~ 25918481 (-)
ica1 LOC106582178 coding downstream 230020 25883818 ~ 25895863 (-)
LOC110515765 LOC106582155 coding downstream 271459 25837637 ~ 25854424 (-)
LOC110515941 etv1 coding upstream 41334 26167468 ~ 26186034 (-)
LOC110515948 LOC106582257 coding upstream 62788 26188922 ~ 26252950 (-)
LOC110515972 LOC106582276 coding upstream 149628 26275762 ~ 26316108 (-)
LOC110515986 meox2 coding upstream 191440 26317574 ~ 26331168 (-)
LOC110515999 LOC106582287 coding upstream 225026 26351160 ~ 26387451 (-)
G239515 NA non-coding downstream 68882 26055575 ~ 26057001 (-)
G239519 NA non-coding downstream 189172 25936223 ~ 25936711 (-)
G239504 NA non-coding downstream 226753 25898818 ~ 25899130 (-)
G239502 NA non-coding downstream 249920 25874811 ~ 25875963 (-)
G239836 NA non-coding upstream 20086 26146220 ~ 26146503 (-)
G239853 NA non-coding upstream 60869 26187003 ~ 26187203 (-)
G239864 NA non-coding upstream 82550 26208684 ~ 26209104 (-)
G239904 NA non-coding upstream 194181 26320315 ~ 26320540 (-)
G239939 NA non-coding upstream 244618 26370752 ~ 26370991 (-)
LOC110515750 LOC106582146 other downstream 301126 25822812 ~ 25825108 (-)
LOC110515384 LOC106582009 other downstream 889516 25171287 ~ 25236536 (-)
LOC110515208 LOC106581894 other downstream 1159675 24936516 ~ 25052970 (-)
LOC110515154 LOC106605289 other downstream 1355560 24767049 ~ 24799511 (-)
G237832 NA other downstream 1604339 24521219 ~ 24521544 (-)
G240409 NA other upstream 442967 26569101 ~ 26569522 (-)
G240464 NA other upstream 548458 26674592 ~ 26675033 (-)
LOC110516631 LOC106582601 other upstream 944921 27070914 ~ 27097259 (-)
LOC110516667 LOC106582624 other upstream 986048 27111084 ~ 27127488 (-)
LOC110516678 LOC106605187 other upstream 1029434 27154680 ~ 27159987 (-)

Expression


G239822 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G239822 Expression in each Bioproject

Bar chart with 2 bars.
G239822 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network